We narrowed to 3,704 results for: biorxiv
-
Plasmid#246014PurposesnuABE4.1 with MLH1-SB fused to the C-terminus via P2A.DepositorInsertPediculus humanus ADAR deaminase domain (E438Q, I536S, E637F mutant)
TagsMLH1-SBExpressionMammalianMutationE438Q, I536S, E637F, with 10 amino acids truncati…PromoterCMVAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEE-mScarlet3-IRES-PuroR
Plasmid#242415PurposeSpectral unmixing: mScarlet3 onlyDepositorInsertsmScarlet3
IRES-PuroR
UseSelf-amplifying rnaExpressionMammalianAvailable SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p4919
Plasmid#239357PurposeExpression of Rice Cullin, Rice SKP1, Rice Rbx1, and G418 resistance by read through transcription after integration into the tubulin locusDepositorInsertRice CUL1, Rice SKP1, Rice RBX1 and G418 resistance
TagsCUL1, SKP1 and RBX1 are all Ty epitope taggedPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5179
Plasmid#239358PurposeExrpession of Rice TIR1 F74->G, Rice ARF fragment and blaticidin resistance by read through transaction after integration int the PFR1 locusDepositorInsertRice TIR1, Rice ARF16 and blasticidin resistance
UseBacterialTagsTIR1 and ARF are both Ty-epitope taggedMutationTIR1 F74->G. ARF16 is residues 784 to 959 onlyPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_CKAR3
Plasmid#238411PurposeMammalian expression of CKAR3 under a CMV promotor.DepositorInsertCKAR3 (PKC sensor)
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-EgI-BlastR
Plasmid#207176PurposeGateway compatible Lentiviral Expression Plasmid EF1a-IRES-BlastRDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EgI-ZeoR
Plasmid#207178PurposeGateway compatible Lentiviral Expression Plasmid EF1a-IRES-ZeoRDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterEf1aAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJAT75
Plasmid#204306PurposeFlippase under heat shock control. HDR integrant marked with ie1-EGFP, expressed in abdomen and mouthpartsDepositorInsertie1-EGFP
UseCRISPRPromoterie1Available SinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMetTU1-A_Sv5K_araC-PBAD_MCD1_MegaB-S9G-R31L-R85L_MegaRNFGLSKJTU_Bba-B0015
Plasmid#202025PurposeExpresses Bacillus megaterium ARG cluster (GvpB S9G-R31L-R85L mutant) in E. coliDepositorInsertBacillus megaterium ARG cluster (GvpB S9G-R31L-R85L mutant)
ExpressionBacterialMutationGvpB S9G-R31L-R85LAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tol2_B-act_dCas9-Vp64-T2A-Citrine
Plasmid#200248PurposeZebrafish transgenics; Plasmid encodes dCas9-Vp64 and could be stably integrated in the zebrafish genome using Tol2 transgenesisDepositorInsertdCas9-Vp64-T2A-Citrine
UseZebrafish expressionAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL2_176
Plasmid#199108PurposeLevel 2 plasmid, barcoded ORI with gentamicin resistance cassette and mScarlet-I reporterDepositorInsertp15A ORI plus NGS barcode 24, gentamicin resistance cassette, mScarlet-I cassette, oriT
UseSynthetic BiologyAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL2_168
Plasmid#199100PurposeLevel 2 plasmid, barcoded ORI with gentamicin resistance cassette and mScarlet-I reporterDepositorInsertRSF1010 ORI plus NGS barcode 14, gentamicin resistance cassette, mScarlet-I cassette, oriT
UseSynthetic BiologyAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pICH-roGFP2-GPXC71S
Plasmid#191698PurposeTi plasmid pICH86988 harbouring roGFP2-GPXC71S -a control roGFP2 fusion not responsive to peroxides used alongside plasmids 191680 and 191677DepositorInsertredox(ro)GFP2-GPXC71S
ExpressionPlantMutationPeroxidatic Cysteine 71 replaced with SerinePromoterCaMV 35SAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTipi2.1_Anti-His [IPI-HAP1/5.13.22] Mouse/Rabbit HC
Plasmid#221363PurposeMammalian expression of Anti-His [IPI-HAP1/5.13.22] Mouse/Rabbit HC; to be used with Anti-His [IPI-HAP1/5.13.22] light chain (Plasmid 221364) to make the antibody.DepositorInsertAnti-His [IPI-HAP1/5.13.22] Mouse/Rabbit HC
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTipi2.1_Anti-His [IPI-HAP1/5.13.22] Mouse/Rabbit LC kappa
Plasmid#221364PurposeMammalian expression of Anti-His [IPI-HAP1/5.13.22] Mouse/Rabbit LC kappa; to be used with Anti-His [IPI-HAP1/5.13.22] heavy chain (Plasmid 221363) to make the antibody.DepositorInsertAnti-His [IPI-HAP1/5.13.22] Mouse/Rabbit LC kappa
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGLU_504
Plasmid#250498PurposeUrease Cluster KO | Erythromycin Resistance Cassette | Conjugative VectorDepositorInsertsermC
ermC
UseSynthetic BiologyExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCA0.324
Plasmid#200621PurposeLevel 0 TSS promoter acceptor vector is LacZ compatible blue/white screening, overhangs allow for assembly with RBS parts in acceptor vector pCA0.325,DepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
EK0720 CMV-TO-BFPmut-3UTR(t70587-long) (FLP-IN)
Plasmid#247274Purposeinactive BFP with long synthetic 3' UTRDepositorInsertBFPmut-3UTR(t70587-long)
ExpressionMammalianMutationWTPromoterCMV-TOAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
cwby0003
Plasmid#232212PurposeGGA cloning sfGFP-AGGA-ccdb-TTCC-HISDepositorInsertccdb
ExpressionBacterialPromoterT7Available SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only