We narrowed to 24,878 results for: promoter
-
Plasmid#163979PurposeMammalian expression vector encoding human NLRP1 UPA-CARD with a C-terminal FLAG tagDepositorAvailable SinceJan. 24, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG-IKZF1-V1-Q146H-FLAG-IRES-GFP
Plasmid#69048Purposelentiviral expression of IKZF1 variant 1 with Q146H mutation and FLAG tagDepositorInsertIKZF1 (IKZF1 Human)
UseLentiviralTagsFLAG and IRES-GFPExpressionMammalianMutationsplice variant 1, Q146HPromoterCAGAvailable SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-mTET2 (N1041)
Plasmid#89737PurposeExpresses the N1041 truncation to mouse TET2 in mammalian cellsDepositorInsertTET2 (Tet2 Mouse)
TagsFlagExpressionMammalianMutationN-term 1041 truncation of mouse TET2 (contains fi…Available SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shLacZ
Plasmid#223222Purposemir30 based shRNA strategy, control shRNADepositorInsertshLacZ
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX303-ARF6-T157N-mNeonGreen
Plasmid#162028PurposeFast cycling ARF mutantDepositorAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-AID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187960PurposeAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaActin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-B103 (LM2963)
Plasmid#208960PurposeA variant CE1 construct with B103 DNA polymerase, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-B103-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Control click editor - pCMV-T7-deadPCV2-nCas9-EcKlenow (EMK492)
Plasmid#208943PurposeA control CE1 construct with catalytically attenuated PCV2 HUH, expressed from CMV or T7 promoters.DepositorInsertdPCV2-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPCV2(Y96F); nSpCas9(H840A); EcKlenow(-exo;D355A/E…PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 6A NLRP1 UPA-CARD-FLAG E1461R
Plasmid#163990PurposeMammalian expression vector encoding human NLRP1 UPA-CARD (dimer interface mutant) with a C-terminal FLAG tagDepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 6A NLRP1 UPA-CARD-FLAG M1457A
Plasmid#163988PurposeMammalian expression vector encoding human NLRP1 UPA-CARD (dimer interface mutant) with a C-terminal FLAG tagDepositorAvailable SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG-IKZF2-V2-FLAG-IRES-GFP
Plasmid#69049Purposelentiviral expression of IKZF2 variant 2 with FLAG tagDepositorInsertIKZF2 (IKZF2 Human)
UseLentiviralTagsFLAG and IRES-GFPExpressionMammalianMutationsplice variant 2PromoterCAGAvailable SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX301-RFP-GGA3 NGAT
Plasmid#162031PurposeExpresses NGAT sequence of GGA3DepositorInsertGGA3 NGAT (GGA3 Human)
UseLentiviralAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shQKI-3371
Plasmid#115455PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-R438E
Plasmid#91984PurposeExpresses FLAG-HA-AGO2 (R438E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
plenti-UbcP-IKZF1-V2-3xHA-pGK-Pur
Plasmid#69051Purposelentiviral expression of IKZF1 with HA tagDepositorInsertIKZF1 (IKZF1 Human)
UseLentiviralTagsHAExpressionMammalianMutationsplice variant 2PromoterUBCAvailable SinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX311 HRAS
Plasmid#117749PurposeOpen reading frame vector encoding HRASDepositorInsertRASH1 (HRAS Human)
UseLentiviralTagsV5ExpressionMammalianMutationClosed vector so will not read through the V5 reg…PromoterEF1aAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaMyosin binding domain
Plasmid#187275PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Myosin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaMyosin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only