We narrowed to 44,012 results for: gats
-
Plasmid#82863PurposeGateway Donor vector containing RB1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223_BRAF_p.L485S
Plasmid#82837PurposeGateway Donor vector containing BRAF, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BRAF_p.A762E
Plasmid#82823PurposeGateway Donor vector containing BRAF, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BRAF_p.H574Q
Plasmid#82825PurposeGateway Donor vector containing BRAF, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BRAF_p.H574N
Plasmid#82813PurposeGateway Donor vector containing BRAF , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BRAF_p.L613F
Plasmid#82822PurposeGateway Donor vector containing BRAF, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BRAF_p.R682W
Plasmid#82810PurposeGateway Donor vector containing BRAF, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
tPA-TGFa-SPMn-SpyTag003
Plasmid#246649PurposeExpresses tPA-TGFa-SPMn-SpyTag003 in mammalian cells for calcium-induced NeissLock protein ligation to epidermal growth factor receptor (EGFR)DepositorInserttPA-TGFa-SPMn-SpyTag003
TagsSignal peptide and SpyTag003ExpressionMammalianMutationConstruct contains the tPA signal peptide, Kringl…PromoterCMV promoterAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
JDW 832 (pDONR221-V5-mTagBFP2-KRAS4A-G12D)
Plasmid#156404PurposeGateway middle entry clone encoding V5-tagged mTagBFP2-fused to human KRAS4A with G12D mutation, includes a stop codonDepositorInserthuman mutant KRAS4A-G12D (KRAS Human)
UseGateway cloningTagsmTagBFP2Mutationmutant KRAS4A-G12DAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PRDX5K85R
Plasmid#98694PurposeGateway cloning of human PRDX5-K85RDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PRDX5K83R
Plasmid#98693PurposeGateway cloning of human PRDX5-K83RDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-PRDX5E80K
Plasmid#98692PurposeGateway cloning of human PRDX5-E80KDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SERPINB5_WT_V5
Plasmid#83002PurposeGateway Donor vector containing SERPINB5, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorInsertSERPINB5 (SERPINB5 Human)
UseGateway entry vectorMutationS176P; AA190-192delTDTins25;AA194-196delPVQinsSIP…PromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GTPBP8_WT_V5
Plasmid#82979PurposeGateway Donor vector containing GTPBP8, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_HAVCR2_WT_V5
Plasmid#82965PurposeGateway Donor vector containing HAVCR2, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only