We narrowed to 16,297 results for: grna
-
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Grin1-smFP-V5 KI
Plasmid#183439PurposeFlpON knock-in for GluN1-smFP-V5 (amino acid position: A20)DepositorInsertgRNA and smFP V5 donor
UseCRISPRExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEDJ-87
Plasmid#163085PurposeMarkerFree plasmid for integration of pADH1-MCP-VPR into site XI-5DepositorInsertVPR
TagsMCPExpressionYeastPromoterADH1Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-pleCopyCatcher
Plasmid#174061PurposeCopyCatcher insertion donor for the pale locusDepositorInsertPale (Pale Synthetic, Fly)
ExpressionBacterialAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGuide-P1-O1a (EL702)
Plasmid#140040PurposeCRISPR DuMPLING negative control plasmid with probe/barcode P1 and negative control lacO1array spacer in the sgRNA. Also template for library PCRs.DepositorInsertbarcode P1 and sgRNA lacO1 array
UseSynthetic BiologyAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
S1_AscI_V5-gateway_Bsu36I
Plasmid#128467Purposedestination vector with N-terminal V5 tagDepositorInsertdestination vector with N-terminal V5 tag
ExpressionBacterialAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
S2_AscI_HA-gateway_Bsu36I
Plasmid#128468Purposedestination vector with N-terminal HA tagDepositorInsertdestination vector with N-terminal HA tag
ExpressionBacterialAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC-U61-SapI
Plasmid#112808PurposegRNA cloning vector for expressing 1-3 gRNAs in DrosophilaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
ExpressionMammalianAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN220
Plasmid#91681PurposeExpress sgRNA targeting human VRK2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN221
Plasmid#91682PurposeExpress sgRNA targeting human VRK2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN154
Plasmid#91683PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX203
Plasmid#89267PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA02DepositorInsertOsDEP1-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX202
Plasmid#89266PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA01DepositorInsertOsDEP1-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX200
Plasmid#89264PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01DepositorInsertOsYSA-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX199
Plasmid#89263PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA02DepositorInsertOsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas56
Plasmid#82394PurposesgRNA targeting YFP +46 from TSS; template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas55
Plasmid#82393PurposesgRNA targeting YFP +172 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[S1Apt]
Plasmid#68425PurposeTransient expression in mammalian cells of an "INT" construct_bearing the "S1" streptavidin aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct with S1 streptavidin aptamer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only