We narrowed to 1,636 results for: αGFP
-
Plasmid#139640PurposeGFP-tagged gene expressionDepositorInsertPTPRA_deltaD1 (PTPRA Human)
TagsGFPExpressionMammalianMutationD1 domain deletionPromoterCMVAvailable sinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pN-PITCh-FAID
Plasmid#127885PurposeProvides the repair template with PP2Ac microhomology on each end for PP2Ac N-ter FAID taggingDepositorAvailable sinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RT001-LVB
Plasmid#163381PurposeSecond generation lentiviral vector to express anti-GFP(LaG17) module in the G-baToN systemDepositorInsertLaG17-VEEGFRtm-BFP (LVB)
UseLentiviralTagsBFPExpressionMammalianPromoterEF1AAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Flp-DOG-NW
Plasmid#75469PurposeFlp recombinase dependent on GFP (Flp-DOG) for rAAV production and expression in mammalian cellsDepositorHas serviceAAV1InsertFlp-DOG
UseAAV and Synthetic BiologyExpressionMammalianPromoterEF-1aAvailable sinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET22b Ag43 160N 6H sfGFP-R5 AmpR
Plasmid#225139PurposeRecombinant Ag43 protein fused to silaffin-R5 and sfGFP. pelB as the periplasmic signal. His-tag for purification. TEV enzyme recognition site between Ag43 alpha subunit and the fluorescent protein.DepositorInsertAg43 protein fused to silaffin-R5 and sfGFP
TagsHis tagExpressionBacterialPromoterT7Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP(N-glyc)-Tac-TC
Plasmid#162496PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in the N-terminus in mammalian cells, and there is one N-glycosylation site in GFP tag.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 TCF3
Plasmid#67110PurposeStandard for cell-free expression benchmarking.DepositorInsertTCF3 (TCF3 Human)
UseCell-free expressionTagsEGFP and HisMutationTruncated isoformPromoterT7Available sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRB2963
Plasmid#8678DepositorAvailable sinceJune 30, 2005AvailabilityAcademic Institutions and Nonprofits only -
pHNF4A-Enh_Gsta2-IRES2-H2BeGFP
Plasmid#247049PurposeThis plasmid was employed to generate the mouse model used in this study. It contains the human HNF4A gene enhancer linked to the Shh mini-promoter and the Gsta2-IRES2-H2BeGFP. Homologous armDepositorInsertGlutathione S-Transferase Alpha 2 (Gsta2 Mouse)
ExpressionMammalianAvailable sinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_H0-ABD+
Plasmid#234552PurposeCTNNA1 enhanced-actin-binding domain mutationsDepositorInsertmEGFP:hCTNNA1_H0-ABD+ (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationR666G, A667S, I668G, M669SPromoterCMVAvailable sinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_WT-ABD
Plasmid#234553PurposeCTNNA1 M-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa 273-635PromoterCMVAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_E307K
Plasmid#234560PurposeCTNNA1 butterfly eye mutantDepositorAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_R551A
Plasmid#234558PurposeCTNNA1 M2-M3 salt-bridge disrupting mutantDepositorAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS406-PHO5-GFP-CERT PH domain
Plasmid#58725PurposeExpresses GFP-Tagged CERT PH domain in yeastDepositorInsertcollagen, type IV, alpha 3 binding protein PH domain (CERT1 Human)
TagsGFP and MycExpressionYeastPromoterPHO5Available sinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hACE2-hygro
Plasmid#161758PurposeExpresses human ACE2 in mammalian cellsDepositorAvailable sinceNov. 5, 2020AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
APP_pcDNA6.2/EmGFP-Bsd
Plasmid#176954PurposeMammalian expression vector encoding APP and EmGFP-BsdDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAPP (APP Human)
ExpressionMammalianPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-TC
Plasmid#162492PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FLAG-mPar6a WT
Plasmid#86148PurposeFLAG tagged mouse Par6 wild type - Binds to aPKC, Par3, Lgl, Cdc42DepositorAvailable sinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only