We narrowed to 872 results for: gcat
-
Plasmid#76604Purpose3rd generation lentiviral gRNA plasmid targeting human DGUOKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
CKB gRNA (BRDN0001145509)
Plasmid#76589Purpose3rd generation lentiviral gRNA plasmid targeting human CKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP3K4 gRNA (BRDN0001146051)
Plasmid#76513Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK19 gRNA (BRDN0001148326)
Plasmid#76505Purpose3rd generation lentiviral gRNA plasmid targeting human CDK19DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FASTKD2 gRNA (BRDN0001148171)
Plasmid#76304Purpose3rd generation lentiviral gRNA plasmid targeting human FASTKD2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS1 gRNA (BRDN0001147960)
Plasmid#76199Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK3 gRNA (BRDN0001145644)
Plasmid#75976Purpose3rd generation lentiviral gRNA plasmid targeting human STK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK2A2 gRNA (BRDN0001144724)
Plasmid#75586Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK2A2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK2A2 gRNA (BRDN0001147190)
Plasmid#75587Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK2A2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ETNK1 gRNA (BRDN0001148358)
Plasmid#75532Purpose3rd generation lentiviral gRNA plasmid targeting human ETNK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BCKDK gRNA (BRDN0001147891)
Plasmid#75504Purpose3rd generation lentiviral gRNA plasmid targeting human BCKDKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-shFMR1-mCherry
Plasmid#222963PurposeMake lentivirus to knock down human FMR1 geneDepositorInsertFMR1 shRNA (FMR1 Human)
UseLentiviralAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgCnr1
Plasmid#209196PurposeMutagenesis of Cnr1DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149518)
Plasmid#77529Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 gRNA (BRDN0001147365)
Plasmid#76183Purpose3rd generation lentiviral gRNA plasmid targeting human FGFR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IKBKB gRNA (BRDN0001145579)
Plasmid#76090Purpose3rd generation lentiviral gRNA plasmid targeting human IKBKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits