We narrowed to 19,449 results for: tec
-
Plasmid#139322PurposePlasmid expressing a sgRNA to introduce BRCA2 V2102I using base editingDepositorInsertsgRNA to insert BRCA2 V2102I using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 E2772K
Plasmid#139323PurposePlasmid expressing a sgRNA to introduce BRCA2 E2772K using base editingDepositorInsertsgRNA to insert BRCA2 E2772K using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145885)
Plasmid#80196Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
NUAK1 gRNA (BRDN0001145557)
Plasmid#75575Purpose3rd generation lentiviral gRNA plasmid targeting human NUAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1A gRNA (BRDN0001487080)
Plasmid#77962Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1B gRNA (BRDN0001146307)
Plasmid#77085Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1B gRNA (BRDN0001148929)
Plasmid#77086Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001147559)
Plasmid#78005Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS2 gRNA (BRDN0001487102)
Plasmid#78006Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PatoM-LOG241
Plasmid#72847PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. LOG241 backbone.DepositorInsertPatoM
ExpressionBacterialPromoterPatoMAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
ADCK3 gRNA (BRDN0001147832)
Plasmid#77321Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK3DepositorInsertADCK3
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ADCK3 gRNA (BRDN0001146491)
Plasmid#77323Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK3DepositorInsertADCK3
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-Venus-FLARE-AKAR
Plasmid#123331PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertVenus-Venus-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, and Xpress…ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-EcoCas6
Plasmid#106274PurposeEncodes E.coli CRISPR Type I-E CasE with N-terminal fusion of Flag tag epitope and nuclear localization signal driven by CMV promoterDepositorInsertEcoCasE
UseCRISPRTagsFlag, NLSExpressionMammalianPromoterCMVAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_LbCas12a.DR
Plasmid#155049PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - LbCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and LbCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
PAK4 gRNA (BRDN0001147629)
Plasmid#77573Purpose3rd generation lentiviral gRNA plasmid targeting human PAK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ADRBK2 gRNA (BRDN0001487158)
Plasmid#77943Purpose3rd generation lentiviral gRNA plasmid targeting human ADRBK2DepositorInsertADRBK2
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only