We narrowed to 9,720 results for: CAG
-
Plasmid#258253PurposeLentiviral expression of CRISPRi RIOK1 sgRNA #3DepositorAvailable SinceJuly 8, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-hNC-gRNA2
Plasmid#249201PurposesgRNA controlDepositorInsertNon-Targeting
UseCRISPR and LentiviralPromoterU6Available SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAJS1222 SOCS4-HA-IRES-Puro-T2A-mTagBFP2
Plasmid#250756PurposeVector for lentiviral expression of SOCS4-HA with a Puro-T2A-mTAGBFP2 markerDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgHK2_14
Plasmid#239257Purposelentiviral vector expressing Cas9 and an sgRNA targeting HK2DepositorInsertsgRNA_14 targeting HK2 (HK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
Setd1a gRNA#3
Plasmid#235252PurposeCas9-mediated knockout of Setd1a in mammalian cellsDepositorAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-sgRXRa4-1; EF1a-mScarlet
Plasmid#242889PurposeFor lentiviral Crispr/Cas9 mediated knockout of mouse RXRa, using a guide RNA against exon 4, coupled to EF1a-driven mScarletDepositorInsertsgRNA targeting Rxra
UseCRISPR and LentiviralTagsmScarletExpressionMammalianPromoterU6Available SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 R0+R1+R3 +SV40 base prom-GFP-IRES-AP
Plasmid#225892PurposeEnhancer reporterDepositorInsertR0+R1+R3
TagsEGFPExpressionMammalianAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb13198
Plasmid#219873PurposeThe base plasmid of TUNEYALI forTF08DepositorInsertContains gRNA targeting TF08 ( YALI1_D33640g) and homologous arm matching TF08
ExpressionYeastAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA047_Podxl
Plasmid#232932PurposeExpression vector for a sgRNA against the mouse Podxl locus and SpCas9 with T2A-Puromycin resistance gene.DepositorInsertCas9-T2A-PuroR (Podxl S. pyogenes)
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL518
Plasmid#231160PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEE771
Plasmid#231159PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEE485
Plasmid#231158PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_1
Plasmid#217433PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 1 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G13 mutant
Plasmid#231915PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1158 by implementing Asn-to-Gln mutationDepositorAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G14 mutant
Plasmid#231916PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1173 by implementing Asn-to-Gln mutationDepositorAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G15 mutant
Plasmid#231917PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1194 by implementing Asn-to-Gln mutationDepositorAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only