We narrowed to 2,760 results for: FAS
-
Plasmid#124802PurposeHDR template to knock-in mouse IgG1 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG1 producing cell lines.DepositorInsertMurine IgG1
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianPromoter-Available SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG3-srt-his
Plasmid#124805PurposeHDR template to knock-in mouse IgG3 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG3 producing cell lines.DepositorInsertMurine IgG3
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJL-mGold2t
Plasmid#231762PurposeExpression of mGold2t in yeast cellsDepositorInsertmGold2t
ExpressionYeastMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterpTDH(GAP promoter)Available SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCPF101-pfQC-cyclase dead
Plasmid#184878Purposeexpresses soluble plasmodium falciparum QC protein with a histag, cyclase dead mutantDepositorInsertpfQC-cyclase dead
TagsHis tagExpressionBacterialMutationF77A & Q79AAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX(I154F)-HA
Plasmid#14988DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1 and HAExpressionBacterialMutationchanged isoleucine 154 to phenylalanineAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX(T133A)-HA
Plasmid#14989DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1 and HAExpressionBacterialMutationchanged threonine 133 to alanineAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX(T133E)-HA
Plasmid#14990DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1 and HAExpressionBacterialMutationchanged threonine 133 to glutamic acidAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX-HA(AscI)
Plasmid#15404DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1 and HAExpressionBacterialMutation700 bp insert can be released by digestion with r…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-N1 PH-PLCd (wild-type) (PH-PLCd-mEos2)
Plasmid#162877PurposeExpression in mammalian cells of Plekstrin-homology domain of Phospholipase C delta tagged with mEos2 to perform sptPALMDepositorInsertpleckstrin homology domain of PLCδ1 (phospholipase C-δ1) (PLCD1 Human)
TagsmEos2ExpressionMammalianMutationInsert consists of AA1-170Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 PA-PLA1 (EGFP-PA-PLA1)
Plasmid#162880PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with EGFPDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsEGFPExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>m2a(silent)-srt-his
Plasmid#124807PurposeHDR template to knock-in FC silent mIgG2a isotype in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to FC silent producing cell lines.DepositorInsertMurine IgG2a (Fc silent)
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationL234A/L235A/N297AAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>Fab-srt-his
Plasmid#124810PurposeHDR template to knock-in sortag and histag in rat IgG2a heavy chain locus. Use in combination with PX459-gR2A_Hinge to convert rat IgG2a hybridoma to Fab' fragment producing cell lines.DepositorInsertrat IgG2a Hinge-G4S-Sortag-Histag
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterialPromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBlue-hFX-HA(NcoI/EcoRI)
Plasmid#15405DepositorInserthuman frataxin cDNA (FXN Human)
TagsAU1 and HAExpressionBacterialMutationinsert can be released by digestion with REs NcoI…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-hFX-promotor(2kb, distal)
Plasmid#14981DepositorInserthuman frataxin promoter fragment (FXN Human)
UseLuciferaseMutationincludes distal fragment of human frataxin promot…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
FXN_Halo_N_allele
Plasmid#178141PurposeDonor vector for endogenous tagging of human FXN at the N-terminus with halotagInsertHalotag (FXN Human)
UseDonor vectorAvailable SinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only