We narrowed to 44,723 results for: Ina
-
Plasmid#175515PurposeFor protein expression of R99A nsp1 CoV2DepositorInsertR99A nsp1 CoV2
TagsGST tagExpressionBacterialPromotertac promoterAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
L-YARS2-9
Plasmid#166533PurposescFv of a human scaffold targeting Tyrosyl-tRNA synthetase 2, mitochondrial. Antigen coverage aa 31-477 of 477DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Strep/HA-UBE2QL1
Plasmid#124665PurposeExpresses UBE2QL1 with N-terminal Strep-HA tag in mammalian cellsDepositorAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-AP-His
Plasmid#72035PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4b-Fc-His
Plasmid#72155PurposeExpresses the extracellular region of the Sema4B protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLXSN-FLK1 TM
Plasmid#65249PurposeExpression of dominant negative FLK1 in mammalian cellsDepositorInsertFLK1 TM (Kdr Mouse)
UseRetroviralExpressionMammalianMutationdeleted AA 786-1346PromoterLTRAvailable SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp1-AP-His
Plasmid#71971PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4f.b-Fc-His
Plasmid#72159PurposeExpresses the extracellular region of the Sema4F, isoform b protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.66kb-EGFP
Plasmid#153165PurposeTruncated mouse gamma-synuclein (mSncg-0.66kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
O-MARS-11
Plasmid#166541PurposescFv of a human scaffold targeting Methionyl-tRNA synthetase. Antigen coverage aa 1-225 of 900DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4CTF
Plasmid#17797DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment only, amino acids 676-1…Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pUAST-SIK3 K70M
Plasmid#52973Purposeinsect expression of SIK3 K70M (kinase dead mutant)DepositorAvailable SinceMay 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB321
Plasmid#68649PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKM-IRES-hrGFP
Plasmid#73405PurposeMammalian expression of mouse PKM and hrGFPDepositorInsertPKM (Prkcz Mouse)
Tags3xFLAG and pIRES-hrGFP-2aExpressionMammalianMutationtruncated, constitutively active formPromoterCMVAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Clim-DC2-NMM-tdtomato
Plasmid#129557PurposepClimDC-NMM:tdT cell membrane markerDepositorInsertN-Myristoylation motif (NMM) fused to tdtomato
ExpressionBacterialAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pS23.U6<ActB.mus_C-term-KI_gRNA
Plasmid#207408PurposegRNA from a U6 promoter targeting the mouse ActB near the 3' end of the ORF. Used for C-terminal knockin by DSB repair. [Lab plasmid ID: TU260]DepositorInsertActB
UseCRISPR and Mouse TargetingPromoterU6Available SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Plxnb3-Fc-His
Plasmid#72130PurposeExpresses the extracellular region of the PlexinB3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3d(L)-AP-His
Plasmid#72017PurposeExpresses the Sema3D protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB121
Plasmid#68575PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only