We narrowed to 25,289 results for: promoter
-
Plasmid#219689PurposeLevel 1 preswitched History-dependent target without promoter, switch by Bxb1, output: mCherry then NeonGreen (for transformation, Kan plant resistance, Kan bacteria resistance).DepositorInsertT2PsB (mtagBFP2, mCherry, NeonGreen)
ExpressionPlantAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
MUT_S1-N
Plasmid#218398Purpose3-exon minigene, with SRSF1 motif-rich middle exon, neutral region in second intron, and AG>GG mutation in final 3' splice siteDepositorInsertModified CHO DHFR minigene
ExpressionMammalianPromotertetracycline-responsive promoterAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
MUT_N-H1
Plasmid#218397Purpose3-exon minigene, with neutral middle exon, hnRNPA1 motif-rich region in second intron, and AG>GG mutation in final 3' splice siteDepositorInsertModified CHO DHFR minigene
ExpressionMammalianPromotertetracycline-responsive promoterAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCT03
Plasmid#212150PurposePlasmid expressing alanine dehydrogenase under inducible promoter PT7 control. The enzyme is thermophilic and works best at 50 C.DepositorInsertalanine dehydrogenase
Tags6x HisExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G2-Km ymTurquoise2
Plasmid#193958PurposeTEF1 promoter controlled expression plasmid with G418 resistance for expressing ymTurquoise2 in budding yeastDepositorInsertymTurquoise2
ExpressionYeastPromoterTEF1Available SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
p416-GPD-HA-PPK(mutant)
Plasmid#183944PurposeExpresses HA-tagged catalytic mutant of E. coli PPK from yeast GPD promoterDepositorInsertPPK(mutant) (ppk E. coli)
TagsHAExpressionYeastMutationmutations in His435, His454, and His592 to AlaninePromoterGPDAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL1271
Plasmid#129282PurposeExpression plasmid with pLL1270 as backbone and alpha-Xylp(Ga0256695_ 1211)DepositorInsertalpha-Xylp_1211 (Ga0256695_ 1211)
ExpressionBacterialPromoterClostridium thermocellum DSM1313 Cellobiose Phosp…Available SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
brr2-R1107M pRS313
Plasmid#111417Purposebrr2-R1107M (endogenous promoter)DepositorInsertBRR2
ExpressionYeastMutationR1107M aa mutation (note, not an RP allele)AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.GFP
Plasmid#57818PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGPromoterEFS and hU6Available SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-M-MLV(WT) (DRR1012)
Plasmid#217799PurposeVariant CE1 construct with wild-type M-MLV revese transcriptase (RT), expressed from CMV or T7 promotersDepositorInsertPCV2-XTEN-nSpCas9-BPNLS-M-MLV-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-SMARCA4
Plasmid#65391PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLX317-SNAI1
Plasmid#115446PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
ppyCAG_RNaseH1_WKKD
Plasmid#111905PurposeExpress WKKD mutated RNASEH1 in mammalian cell. The combination of three specific mutations (W43A, K59A, K60A) in the binding domain prevents the enzyme from binding to RNA/DNA hybridsDepositorInsertRNASEH1 (RNASEH1 Human)
TagsV5ExpressionMammalianMutationChanged D 210 to N, W 43 to A, K 59 to A, K 60 to…Available SinceJuly 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Blast
Plasmid#199622PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and blasticidin resistance from EF-1a promoter.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX317-MBNL1
Plasmid#115443PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (IRES-GFP)
Plasmid#85181PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interaction. Co-expresses EGFP for selectionDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX317-MBNL2
Plasmid#115444PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-c-fos-CytoTape-V5
Plasmid#239429PurposeCytoTape signal monomer for recording c-fos promoter transcriptional activityDepositorInsertCytoTape-V5
UseAAVTagsV5-dMBPExpressionMammalianPromoterc-fos promoterAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-tdTomato
Plasmid#62726PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter. Using bGHpA signal. tdTomato has codons varied between the first and second tandem repeats to reduce recombination.DepositorHas ServiceAAV8InsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only