We narrowed to 3,402 results for: aaas
-
Plasmid#77590Purpose3rd generation lentiviral gRNA plasmid targeting human MARK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
BMPR1A gRNA (BRDN0001147772)
Plasmid#77960Purpose3rd generation lentiviral gRNA plasmid targeting human BMPR1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
FRK gRNA (BRDN0001149083)
Plasmid#76241Purpose3rd generation lentiviral gRNA plasmid targeting human FRKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13D/sgKras/Cre
Plasmid#99857PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12S/sgKras/Cre
Plasmid#99853PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12A/sgKras/Cre
Plasmid#99849PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE2 mutant
Plasmid#133309PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 2DepositorInserteIF3B promoter MBE2 mutant (EIF3B Human)
UseLuciferaseExpressionMammalianMutationgccacatgcacc changed to gcAaAaAAcaccPromotereIF3BAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-Sac-Abeta(M1-42)
Plasmid#71875PurposeExpresses the amyloid-beta protein (42 aa), containing an exogenous methionine (Abeta(M1-42)), when expressed in BL21* DE3 p LysS E. coli cellsDepositorAvailable SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-Sac-Abeta(M1-40)
Plasmid#71876PurposeExpresses the amyloid-beta protein (40 aa), containing an exogenous methionine (Abeta(M1-40)), when expressed in BL21* DE3 p LysS E. coli cellsDepositorAvailable SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APP-mGFP
Plasmid#196704PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsmCherry and mEGFPExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUGW-APPSwe-T2A-mCherry
Plasmid#190804PurposeExpress Swedish mutant APP from Ubiquitin C promoter, co-expressing mCherryDepositorAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only