We narrowed to 3,505 results for: cgas
-
Plasmid#77269Purpose3rd generation lentiviral gRNA plasmid targeting human NIM1KDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
TEX14 gRNA (BRDN0001144991)
Plasmid#76833Purpose3rd generation lentiviral gRNA plasmid targeting human TEX14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PTK6 gRNA (BRDN0001162535)
Plasmid#76493Purpose3rd generation lentiviral gRNA plasmid targeting human PTK6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TK1 gRNA (BRDN0001147625)
Plasmid#76423Purpose3rd generation lentiviral gRNA plasmid targeting human TK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIM3 gRNA (BRDN0001148886)
Plasmid#75870Purpose3rd generation lentiviral gRNA plasmid targeting human PIM3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIM3 gRNA (BRDN0001145891)
Plasmid#75869Purpose3rd generation lentiviral gRNA plasmid targeting human PIM3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
WNK4 gRNA (BRDN0001147390)
Plasmid#75657Purpose3rd generation lentiviral gRNA plasmid targeting human WNK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTER SADB shRNA Human
Plasmid#67151PurposeDoxycycline-regulated mammalian expression vector for expressing shRNA against human SADBDepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCF142_U6-sgRNA
Plasmid#225960PurposeU6-sgRNA (recipient). Expresses U6-sgRNA (recipient) for VLP production. This is a recipient vector for cloning of specific SpyCas9 sgRNAs.DepositorInsertU6-sgRNA (recipient)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT-EF-Pdgfrbeta-EGFPN
Plasmid#66790PurposeExpression of murine PDGFRbeta tagged with GFP under the control of EF1a promoterDepositorAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-P2A-EGFP_mRFPstuf
Plasmid#137730PurposeExpresses customizable S. Pyogenes sgRNA from U6 promoter and PuroR-P2A-EGFP from EF-1a promoter. Stuffer contains mRFP from a bacterial promoter, enabling simple visual quality control step of sgRNADepositorTypeEmpty backboneUseCRISPR, Lentiviral, Mouse Targeting, and Syntheti…ExpressionBacterial and MammalianAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2b KI
Plasmid#131487PurposeEndogenous tagging of GluN2b: N-terminal (amino acid position: S34)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-2xPH-TAPP1 R211L mutant
Plasmid#161991PurposeExpresses two mutated tandem repeats of Tapp1 PH domain (phosphoinositide binding-deficient mutant of TAPP1, R211L, can't bind PI(3,4)P2). Fused to eGFPDepositorAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmNeon Green-N1-ARF1-R
Plasmid#202430PurposeMammalian expression vector containing mNeonGreen-tagged ARF1DepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only