We narrowed to 936 results for: trna
-
Plasmid#223414PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDule-pCNF
Plasmid#85494PurposeMachinery plasmid expressing permissive pCNF synthetase and cognate amber suppressing tRNA. Incorporates azidoPhenylalanine.DepositorInsertpara-cyanophenylalanine Mj synthetase
TagsNoneExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
720-2µ-maxHIS3
Plasmid#40612DepositorInsertHIS3 (HIS3 Budding Yeast, Synthetic)
TagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3Available SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xEcoLeuT(CUA)_EF1_sfGFP150TAG
Plasmid#174892Purposeamber suppression reporter sfGFP150TAG with EcoLeuT(CUA) amber suppressor tRNA cassetteDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xBstTyrT(CUA)_EF1 sfGFP150TAG
Plasmid#174891Purposeamber suppression reporter sfGFP150TAG expression, with BstTyr(CUA) amber suppressor tRNA cassetteDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBK-EcTrpRS(H14)
Plasmid#231129PurposeExpresses mutant E. coli TrpRS from a weak glnS promoter for proteome-wide incorporation of tryptophan analogues.DepositorInsertE. coli tryptophanyl tRNA synthetase
ExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSGAb/pEvol-AbTrpRS(H14)
Plasmid#231133PurposeExpresses mutant A. baumannii TrpRS from an inducible lac promoter for proteome-wide incorporation of tryptophan analogues.DepositorInsertA. baumannii tryptophanyl tRNA synthetase
UseAcinetobacter baumannii expressionExpressionBacterialMutationT12A, V151G, V153CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT30
Plasmid#223402PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 and the sgRNA was driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT(UUA)_EF1_sfGFP150TAA
Plasmid#174897Purposeochre suppression reporter sfGFP150TAA expression, with MmaPylT(UUA) ochre suppressor tRNA cassetteDepositorInsertsf GFP
ExpressionMammalianMutation150TAA in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT(UCA)_EF1_sfGFP150TGA
Plasmid#174898Purposeopal suppression reporter sfGFP150TGA expression, with MmaPylT(UCA) opal suppressor tRNA cassetteDepositorInsertsfGFP
ExpressionMammalianMutation150TGA in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
719-2µ-minHIS3
Plasmid#40610DepositorInsertHIS3 (HIS3 Budding Yeast, Synthetic)
TagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMV361_MjTyrRS
Plasmid#193250PurposeExpresses the M. jannaschii tyrosyl-tRNA synthetase (MjTyrRS)DepositorInsertMjTyrRS
ExpressionBacterialPromoterhsp60Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUltra-sY
Plasmid#82417PurposeExpresses Mj aaRS for sulfotyrosine and Mj tRNA for decoding UAG codonsDepositorInsertMethanococcus jannaschii aaRS for sulfotyrosine
ExpressionBacterialMutationTyr32Leu, Leu65Pro, Asp158Gly, Ile159Cys, Leu162L…PromotertacIAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRARE-MBP-DEST
Plasmid#84650PurposeGateway cloning vector expresses MBP-tagged proteins under the control of the IPTG– inducible ptac promoter and also expresses several tRNAs that are rare in E. coli.DepositorTypeEmpty backboneTagsMBPExpressionBacterialPromotertacAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAcBAc1-Ma-tfmW-RSA2
Plasmid#251519PurposeOrthogonal Methanomethylophilus alvus aaRS/tRNA-mediated incorporation of tfm-Tryptophan into sfGFP150TAG in HEK293T cellsDepositorInsertMa-tfmW-RSA2
ExpressionMammalianPromoterCMVAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-EcTrpRS(H14)
Plasmid#231131PurposeExpresses mutant E. coli TrpRS from a derepressed lac promoter for proteome-wide incorporation of tryptophan analogues in E. coli/K. pneumoniae.DepositorInsertE. coli tryptophanyl tRNA synthetase
UseKlebsiella pneumoniae expressionExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-EcTyrRS(VSMA,D165G)
Plasmid#231132PurposeExpresses mutant E. coli TyrRS from a derepressed lac promoter for proteome-wide incorporation of tyrosine in E. coli/K. pneumoniae.DepositorInsertE. coli tyrosyl tRNA synthetase
UseKlebsiella pneumoniae expressionExpressionBacterialMutationY37V, D165G, D182S, P183M, L186A, D265RAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSIP103: pTarget(CyCAST)
Plasmid#200849PurposeTarget plasmid containing CyPSP1 and attachement site for CyCAST.DepositorInsertsPAM for CyCAST + CyPSP1
tRNA-Leu
ExpressionBacterialAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only