We narrowed to 8,837 results for: AMPH
-
Plasmid#172730PurposeEncodes Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBIG2abc_nsp12-His6-3xFlag/nsp7-Linker-nsp8 (SARS-CoV-2)
Plasmid#169184PurposeBaculoviral transfer vector to co-express nsp12-His6-3xFlag and nsp7-Linker-nsp8 fusion in insect cellsDepositorInsertnsp12-His6-3xFlag/nsp7-Linker-nsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsHis6-3xFlag (nsp12 C-terminus) and nsp7-nsp8 fusi…ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_nsp12-3xFlag/nsp7-His6-nsp8 (SARS-CoV-2)
Plasmid#169183PurposeBaculoviral transfer vector to co-express nsp12-3xFlag and nsp7-His6-nsp8 fusion in insect cellsDepositorInsertnsp12-3xFlag/nsp7-His6-nsp8 (ORF1ab SARS-CoV-2)
Tags3xFlag (nsp12 C-terminus) and His6 (as internal t…ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169164PurposeBaculoviral transfer vector to co-express SARS-CoV-2 nsp14 and nsp10 in insect cellsDepositorInsertnsp14/nsp10-6His-3xFlag (ORF1ab SARS-CoV-2, Synthetic)
Tags6His-3xFlag (nsp10 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-hPGK-DEST-IRES-Puro
Plasmid#253773PurposeThird generation lentiviral expression Gateway cloning destination vector under a hPGK promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-DEST-IRES-Puro
Plasmid#253769PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-DEST-IRES-Puro
Plasmid#253777PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-TRE-DEST-UbC-tTSrtTA-IRES-Neo
Plasmid#253780PurposeThird generation lentiviral expression Gateway cloning destination vector under a Tet-On inducible promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-DEST-IRES-Neo
Plasmid#253776PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-DEST-IRES-EGFP
Plasmid#253778PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to EGFP by an IRES.DepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-TRE-DEST-UbC-tTSrtTA-IRES-EGFP
Plasmid#253782PurposeThird generation lentiviral expression Gateway cloning destination vector under a Tet-On inducible promoter for expression of a gene of interest linked to EGFP by an IRES.DepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hPGK-DEST-IRES-Neo
Plasmid#253772PurposeThird generation lentiviral expression Gateway cloning destination vector under a hPGK promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-DEST-IRES-Hygro
Plasmid#253767PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to hygromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-DEST-IRES-Neo
Plasmid#253768PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-TRE-DEST-UbC-tTSrtTA-IRES-Puro
Plasmid#253781PurposeThird generation lentiviral expression Gateway cloning destination vector under a Tet-On inducible promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hPGK-DEST-IRES-Hygro
Plasmid#253771PurposeThird generation lentiviral expression Gateway cloning destination vector under a hPGK promoter for expression of a gene of interest linked to hygromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 5 Spacer
Plasmid#172733PurposeEncodes Part 5 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 4 Spacer
Plasmid#172732PurposeEncodes Part 4 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 3 Spacer
Plasmid#172731PurposeEncodes Part 3 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits