We narrowed to 16,448 results for: GRN
-
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pX330-TP53
Plasmid#227318PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of TP53 for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-EZR
Plasmid#227293PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of EZR for knock-in.DepositorAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL3346 PB-nicking guide-blast
Plasmid#226665PurposePiggyBac cargo vector encoding protective nicking sgRNA marked with blasticidinDepositorInsertprotective nicking sgRNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 MMP2 g2
Plasmid#170825PurposePiggyBac Cas13d sgRNA plasmid for MMP2 knockdownDepositorInsertCas13d MMP2 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 ANXA2 g1
Plasmid#170826PurposePiggyBac Cas13d sgRNA plasmid for ANXA2 knockdownDepositorInsertCas13d ANXA2 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 ANXA2 g2
Plasmid#170827PurposePiggyBac Cas13d sgRNA plasmid for ANXA2 knockdownDepositorInsertCas13d ANXA2 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 CLCN3 g1
Plasmid#170828PurposePiggyBac Cas13d sgRNA plasmid for CLCN3 knockdownDepositorInsertCas13d CLCN3 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-SPNS1-sg1
Plasmid#198566PurposeSPNS1-targeting sgRNA in PX458 vectorDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-SPNS1-sg2
Plasmid#198567PurposeSPNS1-targeting sgRNA in PX458 vectorDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p213-SWITCH-OFF
Plasmid#217888PurposeRetroviral Switch-OFF vector for sgRNA expression; U6-BbsIx2-SWITCH-OFF-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA091
Plasmid#216106PurposeCRISPRa, gRNA expression with modified trRNA to recruit activators via PP7 tags (guide only)DepositorInsertgRNA expression with modified trRNA to recruit activators via PP7 tags
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-SF14P
Plasmid#209448Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the SF14P promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from SF14P promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-kasOP*
Plasmid#209447Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from kasOP* promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα
Plasmid#183454PurposesgRNA targeting rat PKA-RIIα subunitsDepositorInsertsgRNA targeting rat PKA-RIIα (Prkar2a Rat)
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_NFL linker-3xFLAG KI
Plasmid#182679PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker-3xFLAG. Can be used for C-terminal tagging of endogenous NFL with a linker-3xFLAG tag.DepositorInsertNefl-targeting gRNA and linker-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_NFL linker(A6TAG)-3xFLAG KI
Plasmid#182680PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker(A6TAG)-3xFLAG. Can be used for amber codon suppression and click chemistry labeling of endogenous NFL.DepositorInsertNefl-targeting gRNA and linker(A6TAG)-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro Cas13d-eGFP U6 RUNX1 g1
Plasmid#155185PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and RUNX1 gRNA1DepositorInsertCas13d RUNX1 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJW1884
Plasmid#154332PurposesgRNA Target Vector for CRISPRDepositorInsertcxTi10882 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas9n-Nanog-R
Plasmid#122303PurposeExpresses sgRNA targeting mouse Nanog and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic, Mouse)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only