We narrowed to 9,773 results for: REN
-
Plasmid#141737PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TFORF0855
Plasmid#141735PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0854
Plasmid#141734PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0779
Plasmid#141696PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
PL752-hGH-polyA-PGK-puroR
Plasmid#191682PurposeDonor plasmid backbone PGK-puroRDepositorTypeEmpty backboneExpressionMammalianMutationWTAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY251
Plasmid#184153PurposeReprogrammed short tracrRNA for hijacking mRNA of arsenic responsive gene cluster (site 2)DepositorInserts-tracrRNA-Ar2
UseSynthetic BiologyExpressionBacterialPromoteraraBAD promoterAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-T7TS
Plasmid#115250PurposeFor in vitro transcription of human NODAL open reading frame RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 CortW22A mCherry
Plasmid#187268PurposeLenticiral expression of mCherry-Cortactin W22ADepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGAshort
Plasmid#153547PurposeUsed as a donor vector for the targeted correction of a mutation in PIGA exon 6DepositorInsertPIGA (a 603-bp fragment from intron 5 and exon 6)
UseDonor plasmidTagsN/AMutationNo mutationPromoterNo promoterAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pISH-Vmn2r120-TR
Plasmid#108087PurposePreparation of RNA probe for ISH of mouse Vmn2r120 geneDepositorInsertVmn2r120 (Vmn2r120 Mouse)
UseIn vitro transcriptionMutationchanged A to G at nt 1196 of NM_001104591.1Available SinceMay 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 UBE2C guide 2
Plasmid#117071Purposesingle guide RNA targeting UBE2C; guide 2DepositorInsertUBCH10 (UBE2C Human)
UseCRISPRAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmcsg7-mCRT(1-351)
Plasmid#83508PurposeBacterial expression of Calreticulin mutantDepositorAvailable SinceOct. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Pu.1 NGFR
Plasmid#80132Purposeoverexpression of Pu.1DepositorAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB434
Plasmid#68699PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsGlucocorticoid receptor (GR)ExpressionPlantPromoterMpHSP17.8A1 promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB413
Plasmid#68678PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsGlucocorticoid receptor (GR)ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
FH95pUP95GpW (E4)
Plasmid#74034Purposelentiviral expression of Psd95 shRNA and Psd95-GFPpren fusionDepositorInsertPsd95
UseLentiviral and RNAiExpressionMammalianPromoterH1Available SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCardinal-CAF1-C-10
Plasmid#56153PurposeLocalization: Chromatin Assembly Factor 1, Excitation: 604, Emission: 659DepositorInsertCAF1
TagsmCardinalExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
Gal4pBS134-Pleum
Plasmid#60339PurposeContains a promoter of three gal binding sites derived from native galactose promoter coupled with a core promoter derived from native Leucine promoter.DepositorInsertpromoter
UseSynthetic Biology; Yeast synthetic hybrid promoteā¦ExpressionYeastAvailable SinceFeb. 11, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJK_proK16_eGFP
Plasmid#59847PurposeConstitutively expresses eGFP with proK16 promoterDepositorInsertEnhanced Green Fluorescent Protein
Tags6x-HisExpressionBacterialMutationS2R,S65G,S72APromoterproK16Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only