We narrowed to 22,628 results for: Ide

#109651

Muscle specific zebrafish expression of mKate2 fused to rab5c

Rob Parton

Hall et al Nat Commun. 2020 Jul 24;11(1):3711. doi:

Feb. 27, 2020

Academic Institutions and Nonprofits only

#109619

Muscle specific zebrafish expression of mKate2 fused to rab2a

Rob Parton

Hall et al Nat Commun. 2020 Jul 24;11(1):3711. doi:

Feb. 27, 2020

Academic Institutions and Nonprofits only

#109596

Muscle specific zebrafish expression of mKate2 fused to rab11ba

Rob Parton

Hall et al Nat Commun. 2020 Jul 24;11(1):3711. doi:

Feb. 27, 2020

Academic Institutions and Nonprofits only

#109516

Muscle specific zebrafish expression of mKate2 fused to EHD2a

Rob Parton

Hall et al Nat Commun. 2020 Jul 24;11(1):3711. doi:

Feb. 27, 2020

Academic Institutions and Nonprofits only

#91914

Expresses CgCas13a for bacterial expression and contains backbone for spacer cloning

Feng Zhang

Abudayyeh et al Nature. 2017 Oct 4. doi: 10.1038/nature2

Oct. 4, 2017

Academic Institutions and Nonprofits only

#91913

Expresses CaCas13a for bacterial expression and contains backbone for spacer cloning

Feng Zhang

Abudayyeh et al Nature. 2017 Oct 4. doi: 10.1038/nature2

Oct. 4, 2017

Academic Institutions and Nonprofits only

#87593

Encodes Y2H Gal4 DNA binding domain for Prp9

Aaron Hoskins

Carrocci et al Nucleic Acids Res. 2017 Jan 6. pii: gkw1

July 19, 2017

Academic Institutions and Nonprofits only

#81703

Gateway Donor vector containing MAP2K1, part of the Target Accelerator Plasmid Collection.

Jesse Boehm, William Hahn, David Root

Kim et al Cancer Discov. 2016 Jul;6(7):714-26. doi

April 24, 2017

Academic Institutions and Nonprofits only

#81587

Gateway Donor vector containing ERBB2IP , part of the Target Accelerator Plasmid Collection.

Jesse Boehm, William Hahn, David Root

Kim et al Cancer Discov. 2016 Jul;6(7):714-26. doi

April 24, 2017

Academic Institutions and Nonprofits only

#81297

Gateway Donor vector containing IER3 , part of the Target Accelerator Plasmid Collection.

Jesse Boehm, William Hahn, David Root

Kim et al Cancer Discov. 2016 Jul;6(7):714-26. doi

April 24, 2017

Academic Institutions and Nonprofits only

#87396

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87401

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87405

p426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#86381

Vector to measure enhancer responsiveness of candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.

Alexander Stark

Arnold et al Nat Biotechnol. 2016 Dec 26. doi: 10.103

March 27, 2017

Academic Institutions and Nonprofits only

#75297

Expresses Sacsin sr1 (SIRPT1 repeat) domain (84-339) in fusion with GST (bacterial)

Kalle Gehring

Menade et al J Biol Chem. 2018 Aug 17;293(33):12832-1

July 18, 2016

Academic Institutions and Nonprofits only

#74980

Expresses His tagged GINA3 protein in bacteria.

Pradipta Ghosh

Lin et al Mol Biol Cell. 2014 Nov 5;25(22):3654-71

May 26, 2016

Academic Institutions and Nonprofits only

#29039

Pleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).

Elizabeth Simpson

Portales-Casamar et al Proc Natl Acad Sci U S A. 2010 Sep 21. 1

Feb. 22, 2012

Academic Institutions and Nonprofits only