We narrowed to 10,356 results for: plasmids 101
-
Plasmid#82809PurposeGateway Donor vector containing KRAS, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223_KRAS_p.G12Y
Plasmid#82799PurposeGateway Donor vector containing KRAS , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP1049-pAAV-mscRE13-minBGpromoter-tTA2-WPRE-hGHpA
Plasmid#163482PurposeDirect-expressing tTA2 AAV Virus. Alias: AiP1049 - pAAV-AiE2013m-minBG-tTA2-WPRE-HGHpADepositorInserttTA2
UseAAVTagsExpressionMutationPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K85R-VA
Plasmid#98691PurposeLentiviral expression of human PRDX5-K85R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK85RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5E80K-VA
Plasmid#98689PurposeLentiviral expression of human PRDX5-E80K in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationE80KPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5K83R-VA
Plasmid#98690PurposeLentiviral expression of human PRDX5-K83R in mammalian cellsDepositorInsertPRDX5 (PRDX5 Human)
UseLentiviralTagsVA tagExpressionMammalianMutationK83RPromoterCMVAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ERBB2_p.S418T
Plasmid#82859PurposeGateway Donor vector containing ERBB2, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_HSD17B10_WT_V5
Plasmid#82941PurposeGateway Donor vector containing HSD17B10, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
AiP981-pAAV-mscRE4-minBGpromoter-EGFP-WPRE-hGHpA
Plasmid#163484PurposeDirect-expressing EGFP AAV Virus. Alias: AiP981 - pAAV-AiE2004m-minBG-EGFP-WPRE-HGHpADepositorInsertEGFP
UseAAVTagsExpressionMutationPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ac5-STABLE2-RFP-NLS-CycB(1-266)_GFP-E2F1(1-230)_neo
Plasmid#73164Purposemulti-cistronic Vector for expression for Fly_FUCCI probes in insect cellsDepositorUseTagsmRFP1, GFPExpressionInsectMutationCyclin B Fragment aa 1-266 & E2F1 Fragment aa…PromoterAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-HA (dark) WPRE
Plasmid#131007PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of SM_FP-HA, a cytoplasmic fluorescent protein which includes multiple HA epitope tagsDepositorInsertsmFP-HA WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsHA - 10 total HA epitope tagesExpressionMammalianMutation"dark" variant with GGG fluorphore comp…Promoternone (4x polyA to mitigate episomal expression)Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-V5 (dark) WPRE
Plasmid#131006PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of a SM_FP-V5, a cytoplasmic fluorescent protein which includes multiple V5 epitope tagsDepositorInsertsmFP-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsV5 - 10 total of V5 epitope tagExpressionMutation"dark" variant with GGG fluorphore comp…Promoternone (4x polyA to mitigate episomal expression)Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-Myc (dark) WPRE
Plasmid#130987PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of a SM_FP-Myc, a cytoplasmic fluorescent protein which includes multiple Myc epitope tagsDepositorInsertsmFP-Myc WPRE
UseMosaic analysis for dual recombinase-mediated cas…TagsMyc - 10 total Myc tagsExpressionMutation"dark" variant with GGG fluorophore ver…Promoternone (4x polyA to mitigate episomal expression)Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-TMEM106B-M210A_F213A-P2A-Blasticidin
Plasmid#237479PurposeEncodes full-length human TMEM106B. M210A/F213A mutations block S1 binding and SARS-CoV-2 Belgium/GHB-03021/2020 TMEM106B mediated infection, without affecting TMEM106B expression or localization.DepositorInsertTMEM106B (TMEM106B Human)
UseLentiviralTagsP2A-BlasticidinExpressionMammalianMutationM210A + F213APromoterCMVAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-Sox2-17-t2a-Klf4-e2a-Myc
Plasmid#193349PurposetetO-S*KM (Dox-inducible reprogramming lentiviral vector expressing mouse super-Sox + Klf4 + cMyc)DepositorUseLentiviralTagsExpressionMammalianMutationSox2-17 is engineered highly cooperative chimeric…PromoterTetO mini CMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only