We narrowed to 1,635 results for: cag promoter
-
Plasmid#68832PurposeExpresses c-myc-tagged human RAD18 deleting hRAD6 binding domainDepositorInsertc-myc tagged human RAD18 deleting hRAD6 binding domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 C207F
Plasmid#68829PurposeExpresses c-myc-tagged human RAD18 with C207F mutationDepositorInsertc-myc tagged human RAD18 with C207F mutation (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9D10A nickase
Plasmid#216735PurposeExpresses SpCas9-D10A nickase from a miniCMV promoter. For AAV packaging. Derived from pX551-miniCMV-SpCas9, which was a gift from Alex Hewitt (Addgene #107031)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterT7 and mini-CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEdit
Plasmid#232355PurposeThe pEdit series plasmids are derived from the pTarget series plasmids by inserting homologous recombination arms targeting the gene of interest, which enables gene knockout or gene insertion at the tDepositorInsertsgRNA
UseCRISPRAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL0-MtBCP1Pro
Plasmid#159415PurposeMedicago truncatula BCP1 promoter sequence (1108 bp immediately upstream of start codon) in pICH41295 MoClo Golden Gate level 0 acceptor for Pro+5U modules.DepositorInsertMtBCP1 Promoter
UsePuc19-derivedExpressionBacterialAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut AP-1+C/EBP
Plasmid#61292Purposedrives luciferase from mouse IL-6 promoter with mutations in both AP-1 & C/EBP sitesDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated both AP-1 binding site from TGAGTCT to TG…PromoterIL-6 promoter with mutant AP-1 and C/EBP binding …Available SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA3
Plasmid#160213PurposeKnock Down MYDSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA3 targeting collybistin MYD-CBSH3- isoforms (Plasmid #160212)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationTGTATGACCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA2
Plasmid#160211PurposeKnock Down MTLSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA2 targeting collybistin MTL-CBSH3-isoforms (Plasmid #160210)DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationTGACGTTGCTCaGGcTGtACCA (mutations shown in lower …Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA1
Plasmid#160209PurposeKnock Down MQWSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA1 targeting collybistin MQW-CBSH3- isoforms (Plasmid # 160208).DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationGATCGGGAATGCTCaGGcTGtACC (mutations shown in lowe…Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-C3a
Plasmid#184601PurposeFor expression of a fluorescent sensor for C3a complement in mammalian cellsDepositorInsertMTRIA-C3a
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-ENK
Plasmid#184604PurposeFor expression of a fluorescent sensor for enkephalin in mammalian cellsDepositorInsertMTRIA-ENK
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-LTB
Plasmid#184605PurposeFor expression of a fluorescent sensor for leukotriene B4 in mammalian cellsDepositorInsertMTRIA-LTB
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-AVP
Plasmid#184600PurposeFor expression of a fluorescent sensor for vasopressin in mammalian cellsDepositorInsertMTRIA-AVP
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-OT
Plasmid#184596PurposeFor expression of a fluorescent sensor for oxytocin in mammalian cellsDepositorInsertMTRIA-OT
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NPFF
Plasmid#184612PurposeFor expression of a fluorescent sensor for neuropeptide FF in mammalian cellsDepositorInsertMTRIA-NPFF
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-PGE
Plasmid#184617PurposeFor expression of a fluorescent sensor for prostaglandin E2 factor in mammalian cellsDepositorInsertMTRIA-PGE
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NE
Plasmid#184608PurposeFor expression of a fluorescent sensor for norepinephrine in mammalian cellsDepositorInsertMTRIA-NE
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTalpha1-Dre
Plasmid#133925PurposeNeuron-specific expression of DreDepositorInsertHA-Dre
TagsHAExpressionMammalianPromoterCAG promoterAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only