We narrowed to 15,990 results for: nes
-
Plasmid#237460PurposeTransfection-based all-in-one base editor plasmid that expresses both adenine base editor (ABE8e-nSpCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_ABE8e_SpCas9(D10A)_6xNLS
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-evoCDA1-nSpCas9
Plasmid#237461PurposeTransfection-based all-in-one base editor plasmid that expresses both cytosine base editor (evoCDA1-nSpCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_evoCDA1_ssDBD_nickase SpCas9 _6xUGI
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVneo
Plasmid#134982PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
PET-SpCas9-HF1-plus-NLS-6xHis
Plasmid#207381PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertSpCas9-HF1-plus
UseCRISPRTags6xHisExpressionBacterialMutationN497A, Q695A, Q926A, amino acids 1005-1013 replac…PromoterT7Available SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-Sniper SpCas9 (without sgRNA; with silent mutations)
Plasmid#126777PurposeExpression plasmid for human codon-optimized increased fidelity Sniper SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSniper SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationF539S, M763I, K890NPromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-HeFSpCas9
Plasmid#126766PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-HeFSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HeFSpCas9.DepositorInsertB-HeFSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; K848A; Q926A; K1003A; R1060A…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SERK1 A6_pECIA14
Plasmid#114767PurposePrey vector SERK1 A6_pECIA14 should be used with bait vector SERK1 A6_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9-E566-LOV-C450A-D432V(M519)
Plasmid#250779PurposePotent temperature-deactivated SpyCas9DepositorInsertSpyCas9 with an AsLOV2 insertion behind E566 and C450A and D432V mutation
UseCRISPRTags3xFLAGExpressionMammalianMutationC450A, D432VAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA097 HNRNPK_IVS3-Cas9-BFP
Plasmid#249147PurposeOverexpression of SpCas9-BFP with HNRNPK IVS3 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHNRNPK_IVS3-Cas9-TagBFP (HNRNPK Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHNRNPK IVS3 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT121_GalL_nCDA1-VQRBE3
Plasmid#145086PurposeExpressing base editor nCDA1-VQRBE3 in yeast cellsDepositorInsertnCDA1-VQRBE3
UseCRISPRExpressionYeastMutationspCas9(D10A, D1135V, R1335Q, T1337R)PromoterGalLAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
RCAS-Neu HA SIINFEKL
Plasmid#125832PurposeRetroviral expression of rat Neu cDNADepositorInsertNeu (Erbb2 Rat)
UseRetroviralTags2x HA and SIINFEKLExpressionMammalianMutationVal to Glu point mutation of codon 664 and trunca…Available SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
SERK1 A6_pECIA2
Plasmid#114967PurposeBait vector SERK1 A6_pECIA2 should be used with prey vector SERK1 A6_pECIA14.DepositorInsertAT1G71830 (SERK1 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-Octo_VirD2_NLS-Cas9-6xHis
Plasmid#232296PurposeExpresses Cas9 protein fused with octopine-type VirD2-originating NLSDepositorInsertOcto_VirD2_NLS-Cas9-6xHis
UseCRISPRTags6xHis and Octopine-type VirD2-derived NLSExpressionBacterialPromoterT7Available SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-HIS3
Plasmid#232093PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Hyg
Plasmid#232091PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP13798 - pAAV-DLX2.0-minBG-SYFP2-P2A-mScarlet-10aa-H2B-WPRE3-BGHpA (Alias: CN3798)
Plasmid#229935PurposeDLX2.0 is an enhancer sequence, designed to drive cytosolic SYFP2 and nuclear mScarlet expression in forebrain GABAergic neuronsDepositorInsertSYFP2-P2A-mScarlet-10aa-H2B
UseAAVAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-INPP5E-CAAX
Plasmid#202746Purposeexpress plasma membrane targeted fluorescent protein-tagged enzymeDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
B52 + TIMELESS sgSTOP
Plasmid#100713PurposeB52 plasmid expressing TIMELESS sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting TIMELESS (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only