We narrowed to 13,646 results for: sequence
-
Plasmid#221196Purpose601 nucleosome positioning sequence with an additional base pair inserted 22 nt from the dyad on the TA-rich side of the 601DepositorInsert601[insert(+1)TA-rich]
UseUnspecifiedMutation601 has an additional mutation added 22 bp from d…Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_M13_6xSAG
Plasmid#197096PurposeThis plasmid contains the coding sequence for the control peptide M13, which contains a linker with six repeats of serine-alanine-glycine. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CDepositorInsertControl peptide M13, which contains a linker with six repeats of serine-alanine-glycine (SAG)
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-AncSZ
Plasmid#214235PurposeBacterial expression construct of AncSZ, an kinase domain engineered through ancestorial reconstruction of the kinase domains of both SYK and ZAP-70. For in vitro protein tyrosine phosphorylationDepositorInsertSyk kinase (SYK Human)
Tags6xHisExpressionBacterialMutationSequence gained through ancestral reconstruction …PromoterT7Available SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtTAS1c-D2-NbSu-2-AtMIR173a
Plasmid#213401PurposePlant expression vector (2x35S) for expressing a syn-tasiRNA against Nicotiana benthamiana SULFUR gene from AtTAS1c precursorDepositorInsertArabidopsis TAS1c with a syn-tasiRNA sequence at D2 for silencing N. benthamiana SULFUR gene. MIR173 cassette.
ExpressionPlantPromoter2x35SAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC-cUnaG-LPETG
Plasmid#207635PurposeA plasmid encoding photocaged SpyCatcher (pSC) fused to C-terminal UnaG fragment and LPETG sortase recognition sequence.DepositorInsertphotocaged SpyCatcher-GGSGGGSG-cUnaG-LPETG
Tags6xHisExpressionBacterialMutationAmber stop codon at SC's critical lysinePromoterT7Available SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0-EF-54730
Plasmid#202163PurposeLevel 0 plasmid containing a terminator sequence from gene 54730 from Phaeodactylum tricornutum with EF overhangs used to build a level 1 construct.DepositorInsert54730 terminator
UseSynthetic BiologyMutationNoneAvailable SinceSept. 6, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-27877
Plasmid#202110PurposeLevel 0 plasmid containing the promoter from gene 27877 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert27877 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-Fld
Plasmid#202125PurposeLevel 0 plasmid containing the promoter from gene 23658 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertFld promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-54730
Plasmid#202109PurposeLevel 0 plasmid containing the promoter from gene 54730 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert54730 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-51183
Plasmid#202108PurposeLevel 0 plasmid containing the promoter from gene 51183 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert51183 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-GEF
Plasmid#202107PurposeLevel 0 plasmid containing the promoter from gene 41365 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertGEF promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-47740
Plasmid#202106PurposeLevel 0 plasmid containing the promoter from gene 47740 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert47740 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-BCA
Plasmid#202105PurposeLevel 0 plasmid containing the promoter from gene 51305 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertBCA promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-epyC
Plasmid#202104PurposeLevel 0 plasmid containing the promoter from gene 41316 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertepyC promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmPAN2-F1103A-dsRNAres_Y
Plasmid#148044PurposeInsect Expression of DmPAN2-F1103A-dsRNAresDepositorInsertDmPAN2-F1103A-dsRNAres (PAN2 Fly)
ExpressionInsectMutationone silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmCYFIP1_T
Plasmid#147578PurposeInsect Expression of DmCYFIP1DepositorInsertDmCYFIP1 (Sra-1 Fly)
ExpressionInsectMutation5 silent and one non silent A146V mutations compa…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmCup_1-417-CG32016-E_T
Plasmid#147583PurposeInsect Expression of DmCup_1-417-CG32016-EDepositorInsertDmCup_1-417-CG32016-E (cup Fly)
ExpressionInsectMutation5 silent and three no silent mutations H117R, N14…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmNot1_1-226_R
Plasmid#147416PurposeInsect Expression of DmNot1_1-226DepositorInsertDmNot1_1-226 (Not1 Fly)
ExpressionInsectMutation1 silent mutation compared to the sequence given …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only