We narrowed to 11,082 results for: CHL
-
Plasmid#226840PurposePlasmid that encodes a B. Subtilis lipase (BsLipA) gene fusion with N-terminal SNAP and C-Terminal eGFP under a T7 promoter. Compatible with PURExpress for in vitro transcription/translation. ChlorampDepositorInsertLipase A
UseSynthetic BiologyTagsSNAP and eGFPExpressionBacterialMutationR33Q, D34N, K35D, K112D, M134D, Y139C, I157MPromoterT7Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEPMS0CM0031
Plasmid#227517PurposeL0 part - CDS (without STOP codon)DepositorInsertTkTXSS (Taraxacum kok-saghyz taraxasterol synthase)
ExpressionPlantMutationBsaI sites removed by silent mutationAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEPMS0CM0032
Plasmid#227518PurposeL0 part - CDS (without STOP codon)DepositorInsertTcTXSS (Taraxacum coreanum mixed triterpene synthase)
ExpressionPlantMutationBsaI sites removed by silent mutationAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEPMS0CM0026
Plasmid#227519PurposeL0 part - CDS (without STOP codon)DepositorInsertCoMAS (Calendula officinalis mixed-amyrin synthase)
ExpressionPlantMutationBsaI sites removed by silent mutationAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G07110-mKOk
Plasmid#224850PurposePlasmid for expression of AT5G07110.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G07110.1 (PRA1.B6 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G42765-mKOk
Plasmid#224853PurposePlasmid for expression of AT5G42765.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G42765.1 (AT5G42765 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G55530-mKOk
Plasmid#224854PurposePlasmid for expression of AT5G55530.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G55530.1 (AT5G55530 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G63060-mKOk
Plasmid#224858PurposePlasmid for expression of AT5G63060.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G63060.1 (AT5G63060 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT1G48590-mKOk
Plasmid#224834PurposePlasmid for expression of AT1G48590.1 coding sequence tagged with mKOk in plantsDepositorInsertAT1G48590.1 (AT1G48590 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT1G73430-mKOk
Plasmid#224835PurposePlasmid for expression of AT1G73430.1 coding sequence tagged with mKOk in plantsDepositorInsertAT1G73430.1 (AT1G73430 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT1G77730-mKOk
Plasmid#224836PurposePlasmid for expression of AT1G77730.1 coding sequence tagged with mKOk in plantsDepositorInsertAT1G77730.1 (AT1G77730 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT2G20590-mKOk
Plasmid#224837PurposePlasmid for expression of AT2G20590.1 coding sequence tagged with mKOk in plantsDepositorInsertAT2G20590.1 (AT2G20590 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT3G22620-mKOk
Plasmid#224841PurposePlasmid for expression of AT3G22620.1 coding sequence tagged with mKOk in plantsDepositorInsertAT3G22620.1 (AT3G22620 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT3G56110-mKOk
Plasmid#224842PurposePlasmid for expression of AT3G56110.1 coding sequence tagged with mKOk in plantsDepositorInsertAT3G56110.1 (PRA1.B1 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT4G00165-mKOk
Plasmid#224843PurposePlasmid for expression of AT4G00165.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G00165.1 (AT4G00165 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT4G11790-mKOk
Plasmid#224844PurposePlasmid for expression of AT4G11790.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G11790.1 (AT4G11790 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT4G28430-mKOk
Plasmid#224845PurposePlasmid for expression of AT4G28430.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G28430.1 (AT4G28430 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(b)-AT1G22850-mKOk
Plasmid#224831PurposePlasmid for expression of AT1G22850.1 coding sequence tagged with mKOk in plantsDepositorInsertAT1G22850.1 (AT1G22850 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDF_AaRaf1/BSD2
Plasmid#229516PurposeExpresses Anthoceros agrestis chaperones: Raf1,BSD2DepositorInsertsRubisco accumulation factor 1
BSD2
ExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSET_SynPspA
Plasmid#223812PurposeBacterial expression of SynPspA with N-terminal 10xHis-tag and EK cleavage siteDepositorInsertSynPspA
Tags10xHis and NusAExpressionBacterialAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT006
Plasmid#225157PurposeLow copy cloning vector for integration of C-terminal FLAG epitope tag (ChlR). SmaI restriction site immediately upstream of the FLAG epitope. FLAG epitope in opposite orientation of lac promoter.DepositorTypeEmpty backboneUseSynthetic BiologyTagsFLAG epitope tag (35 bp)ExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT005
Plasmid#225156PurposeLow copy cloning vector for integration of C-terminal FLAG epitope tag (ChlR). SmaI restriction site immediately upstream of the FLAG epitope. FLAG epitope in same orientation as lac promoter.DepositorTypeEmpty backboneUseSynthetic BiologyTagsFLAG epitope tag (35 bp)ExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJET-PgpdA
Plasmid#213466PurposeVector containing the gpdA promoter for Golden Gate cloning in the Fg vectorDepositorInsertPromoter of the glyceraldehyde-3-phosphate dehydrogenase
ExpressionBacterialAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CMV-SCLM
Plasmid#216758PurposeAAV2 transfer vector with the CMV promoter for ubiquitous expression of SuperClomeleonDepositorInsertSuperClomeleon followed by WPRE and human growth hormone polyA terminator
UseAAVExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCMV (cytomegalovirus)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBA326
Plasmid#214743PurposeHigh copy glmS-nadE plasmid containing chloramphenicol as antibiotic resistance gene (ARG) for validationDepositorInsertBBa_J23108-RBS(8455)-glmS-RBS(5392)-nadE
ExpressionBacterialAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSV014
Plasmid#214740PurposeHigh copy thyA-infA plasmid containing chloramphenicol as antibiotic resistance gene (ARG) for validationDepositorInsertBBa_J23108-RBS(7504)-thyA-RBS(4427)-infA
ExpressionBacterialAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEG302-JMJ14-ZF
Plasmid#200913PurposeExpress JMJ14-ZF108 in Arabidopsis target FWA geneDepositorInsertJMJ14
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2A-ZF
Plasmid#200915PurposeExpress HD2A-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2A
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHYX173
Plasmid#202817PurposePlasmid expressing the TEV protease, codon-optimized for Saccharomyces cerevisiae.DepositorInsertTEV protease
ExpressionYeastPromoterScPCK1Available SinceNov. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-UnaG-FLAG
Plasmid#203479PurposeFor Agrobacterium transformation. A plastid transit peptide fused UnaG-FLAG under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertPlastid transit peptide fused UnaG-FLAG
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-tagRFP
Plasmid#203482PurposeFor Agrobacterium transformation. tagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertTagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag.
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-HO1(51-231)
Plasmid#203486PurposeFor recombinant protein production in Escherichia coli. His-tagged Arabidopsis thaliana HEME OXYGENASE 1 (HO1) without the plastid transit peptide under the control of the T7 promoter.DepositorInsertArabidopsis thaliana HEME OXYGENASE1 (51 aa – 231 aa)
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB560-NADK2
Plasmid#203760PurposeFor Agrobacterium transformation. tagRFP fused Arabidopsis thaliana NAD KINASE2 (NADK2) under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertNAD KINASE2
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Talin-T48-L432G-Cterminal-mEmerald
Plasmid#202373PurposeTalin(DeltaR2-10)-L432G-mEmeraldDepositorInsertTalin(DeltaR2-10)-L432G-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Talin-T58-L432G-Cterminal-mEmerald
Plasmid#202372PurposeTalin(DeltaR4-10)-L432G-mEmeraldDepositorInsertTalin(DeltaR4-10)-L432G-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Talin-T100-L432G-Cterminal-mEmerald
Plasmid#202371PurposeTalin(FullLength)-L432G-mEmeraldDepositorInsertTalin(FullLength)-L432G-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Talin-T46-L432G-Cterminal-mEmerald
Plasmid#202374PurposeTalin(DeltaR4-12)-L432G-mEmeraldDepositorInsertTalin(DeltaR4-12)-L432G-mEmerald
ExpressionMammalianAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A-AtUBI10-dCas9-24XGP41
Plasmid#202011PurposeMoclo level 1 - Module A, Promoter: AtUBI10, Gene: dCas9-24XGP41, Terminator: HSPDepositorInsertdCas9-24XGP41
UseSynthetic Biology; Moclo level 1 vectorPromoterAtUBI10Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXC3cIfm
Plasmid#193750PurposeExpresses frame-shifted CI under the control of PLUX promoter, p15A origin of replication, Chloramphenicol selectionDepositorInsertFrame-shifted CI
UseSynthetic BiologyExpressionBacterialPromoterPLUXAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM-60-NusA-DmGW182-RBD_F
Plasmid#146290PurposeBacterial Expression of DmGW182-RBDDepositorInsertDmGW182-RBD (gw Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182-delRBD_E
Plasmid#146229PurposeInsect Expression of DmGW182-delRBDDepositorInsertDmGW182-delRBD (gw Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmHPat_57-684_J
Plasmid#146694PurposeInsect Expression of DmHPat_57-684DepositorInsertDmHPat_57-684 (Patr-1 Fly)
ExpressionInsectMutationTwo silent mutations compared to the sequence giv…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmHPat-del57-499_H
Plasmid#146460PurposeInsect Expression of DmHPat-del57-499DepositorInsertDmHPat-del57-499 (Patr-1 Fly)
ExpressionInsectMutationone silent mutation C2340A compared to the sequen…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmHPat_1-499_H
Plasmid#146461PurposeInsect Expression of DmHPat_1-499DepositorInsertDmHPat_1-499 (Patr-1 Fly)
ExpressionInsectMutationtwo silent mutations compared to the sequence giv…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmHPat_1-684_H
Plasmid#146462PurposeInsect Expression of DmHPat_1-684DepositorInsertDmHPat_1-684 (Patr-1 Fly)
ExpressionInsectMutationTwo silent mutations compared to the sequence giv…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmHPat_57-499_H
Plasmid#146463PurposeInsect Expression of DmHPat_57-499DepositorInsertDmHPat_57-499 (Patr-1 Fly)
ExpressionInsectMutationtwo silent mutations compared to the sequence giv…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmHPat-del57-499-dsRNAres_H
Plasmid#146465PurposeInsect Expression of DmHPat-del57-499-dsRNAresDepositorInsertDmHPat-del57-499-dsRNAres (Patr-1 Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-HA-DmHPat-dsRNAres_H
Plasmid#146467PurposeInsect Expression of DmHPat-dsRNAresDepositorInsertDmHPat-dsRNAres (Patr-1 Fly)
ExpressionInsectMutationtwo silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmHPat_1-684_H
Plasmid#146468PurposeInsect Expression of DmHPat_1-684DepositorInsertDmHPat_1-684 (Patr-1 Fly)
ExpressionInsectMutationTwo silent mutations compared to the sequence giv…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only