We narrowed to 3,458 results for: cgas
-
Plasmid#76940Purpose3rd generation lentiviral gRNA plasmid targeting human NEK8DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PRKCH gRNA (BRDN0001149424)
Plasmid#76914Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCHDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCH gRNA (BRDN0001149082)
Plasmid#76915Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCHDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCG gRNA (BRDN0001146495)
Plasmid#76900Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCGDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PCK1 gRNA (BRDN0001146891)
Plasmid#76286Purpose3rd generation lentiviral gRNA plasmid targeting human PCK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYT1 gRNA (BRDN0001147389)
Plasmid#76129Purpose3rd generation lentiviral gRNA plasmid targeting human MYT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKMT1A gRNA (BRDN0001149109)
Plasmid#75880Purpose3rd generation lentiviral gRNA plasmid targeting human CKMT1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCQ gRNA (BRDN0001147386)
Plasmid#75555Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCQDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIB3 gRNA (BRDN0001146652)
Plasmid#77200Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB3DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/MALAT1[WT] (pAVA3171)
Plasmid#239347PurposeExpresses full-length, driven by its own promoter MALAT1 with wild-type ENE and an 11-nt insertion (cgctcgacgta).DepositorInsert10,843 bp of MALAT1 of genomic locus amplified from genomic DNA of Hela cells (MALAT1 Human)
ExpressionMammalianMutationAn 11-nt insertion (cgctcgacgta)Available SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-SOX4
Plasmid#185552PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting SOX4DepositorInsertSOX4 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-hygro-STING R232
Plasmid#102608PurposeRetroviral vector to expression STING R232DepositorAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL A WT
Plasmid#202413PurposeExpression of GFP-tagged PODXL (isoform A) WTDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK1/HRI_sgRNA
Plasmid#218529PurposesgRNA targeting human EIF2AK1/HRIDepositorInsertEIF2AK1 (EIF2AK1 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL B WT
Plasmid#202414PurposeExpression of GFP-tagged PODXL (isoform B) WTDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAP1-1
Plasmid#125837PurposeKO BAP1 geneDepositorInsertBAP1 (BRCA1 associated protein 1) (BAP1 Human)
UseLentiviralAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAP1-2
Plasmid#125838PurposeKO BAP1 geneDepositorInsertBAP1 (BRCA1 associated protein 1) (BAP1 Human)
UseLentiviralAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX301-ARF6-TagRFP
Plasmid#162029PurposeExpression of tagged ARF WTDepositorInsertARF6 (ARF6 Human)
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only