We narrowed to 12,071 results for: shRNA
-
Plasmid#195129Purposedual gRNA vector targeting centromere-proximal locations on Chromosome 7p and 7q in a third generation Cas9 backbone with GFPDepositorInsertChr7 gRNA
ExpressionMammalianAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO SF-HERC2 C4762S (ShB-R)
Plasmid#55614PurposeDox-inducible expression of full length, ShB-resistant, 3xFLAG/STREP tagged C4762S (catalytically inactive) HERC2 in Flp-In T-Rex cellsDepositorInsert3xFLAG tagged HERC2 (C4762S) (HERC2 Human)
Tags3xFLAG and STREPExpressionMammalianMutationC4762 mutated to serine to render HERC2 catalytic…Available SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
DYRK1A gRNA (BRDN0001145031)
Plasmid#76755Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgVRK1 #4-Blast
Plasmid#199647PurposeExpresses Cas9 and sgRNA guide targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149518)
Plasmid#77529Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgAMPKa1
Plasmid#138684PurposeExpresses a human AMPKa1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA1
Plasmid#138187Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA2
Plasmid#138188Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
ERN1 gRNA (BRDN0001162231)
Plasmid#76409Purpose3rd generation lentiviral gRNA plasmid targeting human ERN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 puro hGSDME gRNA1
Plasmid#223519Purposeknocking out hGSDME in human cellsDepositorAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 RB1 sgRNA #1
Plasmid#202516PurposeExpressing Cas9 and sgRNA targeting human RB1 geneDepositorAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-RAB11a KI
Plasmid#131499PurposeEndogenous tagging of RAB11: N-terminal (amino acid position: before startcodon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AKT1 gRNA (BRDN0001149414)
Plasmid#75502Purpose3rd generation lentiviral gRNA plasmid targeting human AKT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Chr1q_Cassette-Integration_gRNA
Plasmid#195126PurposegRNA in a third generation Cas9 vector with GFP, targeting location downstream of Chr1q_centromere-targeting_gRNA for positive-negative selection cassette integrationDepositorInsertChr1q gRNA
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNeo/Cre
Plasmid#67594PurposeExpresses an Neomycin-targeting gRNA and Cre-recombinaseDepositorInsertsgNeo
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only