We narrowed to 24,757 results for: Nov

#124153

Protein expression for funtional studies of cell growth promotion

Megan Finch-Edmondson, Marius Sudol

Gaffney et al Gene. 2012 Nov 10;509(2):215-22. doi: 10

April 29, 2019

Academic Institutions and Nonprofits only

#124156

Protein expression for funtional studies of cell growth promotion

Megan Finch-Edmondson, Marius Sudol

Gaffney et al Gene. 2012 Nov 10;509(2):215-22. doi: 10

April 5, 2019

Academic Institutions and Nonprofits only

#124140

Protein expression for funtional studies of cell growth promotion

Megan Finch-Edmondson, Marius Sudol

Gaffney et al Gene. 2012 Nov 10;509(2):215-22. doi: 10

April 4, 2019

Academic Institutions and Nonprofits only

#113701

Dox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Feb. 14, 2019

Academic Institutions and Nonprofits only

#113699

Dox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Dec. 11, 2018

Academic Institutions and Nonprofits only

#110320

TRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

Aug. 20, 2018

Academic Institutions and Nonprofits only

#86154

Donor plasmid for PARK6 exon5 I368N sequence. Also contains TagBFP and dTomato

Jens Schwamborn

Arias-Fuenzalida et al Stem Cell Reports. 2017 Nov 14;9(5):1423

June 28, 2018

Academic Institutions and Nonprofits only

#110324

TRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

June 20, 2018

Academic Institutions and Nonprofits only

#110323

TRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

June 20, 2018

Academic Institutions and Nonprofits only

#105248

human GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)

Geraldine Seydoux

Paix et al Proc Natl Acad Sci U S A. 2017 Nov 28. p

Feb. 22, 2018

Academic Institutions and Nonprofits only

#98219

Slow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with green light, inactivation max with 625 nm (accelarates closure to ms). Not recommended for in vivo use. Codon optimized for mammalian expression.

Simon Wiegert

Wietek et al Sci Rep. 2017 Nov 2;7(1):14957. doi: 10.

Aug. 22, 2017

Academic Institutions and Nonprofits only

#70667

Human mutant of E2F1 lacking amino acids 193-359

Maria Alvarado-Kristensson

Hoog et al FASEB J. 2011 Nov;25(11):3815-27. doi: 1

May 16, 2017

Academic Institutions and Nonprofits only

#83236

pGST-HRS (257-276) Hs, Expresses the GST-HRS in E.coli

Gali Prag

Levin-Kravets et al Nat Methods. 2016 Nov;13(11):945-952. do

Nov. 22, 2016

Academic Institutions and Nonprofits only