We narrowed to 27,383 results for: GFP
-
Plasmid#135998PurposeS149A G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cellsDepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.0_nucNanobody IRES EGFP
Plasmid#136619PurposePlasmid encoding nuclear localization of the Enhancer nanobody for GFP as a SNAP-Tag-fusion and EGFPDepositorInsertSNAP-Tag-EnhancerNb-NLS (IRES EGFP)
ExpressionMammalianPromoterCMVAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUAST-GFP-RpL10Ab
Plasmid#71729PurposeExpression of Drosophila melanogaster Rpl10Ab-GFP fusionDepositorAvailable sinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B T23N
Plasmid#89450PurposeExpression of GFP-tagged human Rab27B T23N in mammalian cellsDepositorAvailable sinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOmnibac_ZZ_linker_K963_GFP_SNAP
Plasmid#159727PurposeExpresses kinesin-1 (amino acids 1-963) in Sf9 cells with a C-terminal GFP and SNAP tagDepositorInsertKIF5B (full length, 1-963 amino acids), K963 (KIF5B Human)
TagsGFP and SNAP tags and ZZ affinity tagExpressionInsectAvailable sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2B-donor
Plasmid#113823PurposeCRISPR donor plasmid to tag human transcription factor TFAP2B with GFPDepositorInsertTFAP2B homology arms flanking EGFP-IRES-Neo cassette (TFAP2B Human)
UseCRISPRMutationUnknownAvailable sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSNAI2-donor
Plasmid#112378PurposeCRISPR donor plasmid to tag human transcription factor SNAI2 with GFPDepositorInsertSNAI2 homology arms flanking EGFP-IRES-Neo cassette (SNAI2 Human)
UseCRISPRAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHEY1-donor
Plasmid#112297PurposeCRISPR donor plasmid to tag human transcription factor HEY1 with GFPDepositorInsertHEY1 homology arms flanking EGFP-IRES-Neo cassette (HEY1 Human)
UseCRISPRMutationhg38:8:79765311:G>AAvailable sinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-hMeCP2-GFP-R270X
Plasmid#48079PurposeMammalian expression of GFP tagged MeCP2-R270XDepositorInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
TagsGFPExpressionMammalianMutationexpresses AT-Hook R270XPromoterCMVAvailable sinceApril 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAT-WT-HA-GFP11
Plasmid#177719PurposeER protein alpha-1-antitrypsin (WT) fused to an HA tag and the eleventh β-strand of GFPDepositorAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-30nmSAH-DmrA
Plasmid#61680PurposeGFP-labeled SAH scaffold with DmrA attachment siteDepositorInsertmEGFP-30nmSAH-DmrA
Available sinceMarch 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPSup_iGFP
Plasmid#149420PurposePlasmid for STARR-seq in tobacco leaves. Enhancer candidates can be inserted just upstream of the minimal promoter. The GFP reporter gene harbors the IV2 intron.DepositorTypeEmpty backboneExpressionPlantAvailable sinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTRE3G-FLAG-human cGASdeltaN-GFP
Plasmid#186879PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal FLAG and C-terminal GFP fusion (Adamts1 Synthetic, Human)
UseRetroviralTagsFLAG and GFPMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPK720
Plasmid#38147DepositorAvailable sinceOct. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
IST1-GFP
Plasmid#186298PurposeExpresses human IST1 C-terminally fused to GFPDepositorAvailable sinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1aL-nlsGFP-W
Plasmid#126688PurposeConstitutive, ubiquitous, nuclear-localized GFP expression.DepositorInsertnlsGFP
UseLentiviralTags6xHIS and NLSPromoterEF1aLAvailable sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Fuw-AcrIIA4-P2A-GFP
Plasmid#108247PurposeLentiviral vector to express AcrIIA4-P2A-GFPDepositorAvailable sinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRS416-PHO5-GFP-Osh1
Plasmid#58835PurposeExpresses GFP-Tagged Osh1 in yeastDepositorPublicationAvailable sinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab1b
Plasmid#226579PurposeEncodes Rab1b protein labeled with GFPDepositorInsertRab1-B (Ras-related protein)
TagsAcGFP1ExpressionMammalianAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only