We narrowed to 14,066 results for: crispr grnas
-
Plasmid#86779PurposeDisruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9DepositorInsertsgRNA against GLABROUS1
UseSynthetic BiologyExpressionPlantPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) SUP
Plasmid#115490PurposeCRISPR-Cas9 SunTag system to target NtDRMcd (without an NLS) to the SUPERMAN locus with two guide RNAsDepositorInsertg2_U6_g1_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-MRPsg1
Plasmid#87189Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 1DepositorAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-MRPsg2
Plasmid#87190Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 2DepositorAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEG302 5aa SunTag VP64 g4+g17 (FWA)
Plasmid#119672PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with two guide RNAsDepositorInsertg17_U6_g4_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-MRPsg4
Plasmid#87192Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 4DepositorAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-MRPsg3
Plasmid#87191Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 3DepositorAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT.2#2/Cre
Plasmid#173661PurposeExpresses a NT.2-targeting gRNA and Cre-recombinaseDepositorInsertNon-targeting gRNA
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT.3#3/Cre
Plasmid#173662PurposeExpresses a NT.3-targeting gRNA and Cre-recombinaseDepositorInsertNon-targeting gRNA
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf2#1/Cre
Plasmid#173643PurposeExpresses a Nf2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf2 (Nf2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRbm10#2/Cre
Plasmid#173651PurposeExpresses a Rbm10-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rbm10 (Rbm10 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgWrn#1/Cre
Plasmid#173625PurposeExpresses a Wrn-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Wrn (Wrn Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#2/Cre
Plasmid#173610PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgWrn#2/Cre
Plasmid#173626PurposeExpresses a Wrn-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Wrn (Wrn Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf2#2/Cre
Plasmid#173644PurposeExpresses a Nf2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf2 (Nf2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#1/Cre
Plasmid#173609PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only