We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
(326) pAAV SV40-ZsGreen U6-gRNA
Plasmid#163020PurposeFluorescent reporter for Sa gRNA (Bsa1 sites)DepositorInsertZs Green
UseAAVExpressionMammalianPromoterSV40Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHBS952 TARDBP-Exon1-ko-sgRNA1-SpCas9
Plasmid#107857PurposeTo knock-out TDP43DepositorInsertgRNA against TARDBP (Exon 1) (TARDBP Human)
ExpressionMammalianAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'UAG)
Plasmid#170126PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS415-Cas9-VPR
Plasmid#163971PurposeTrifunctional Cas9-VPR fusion protein plasmid for simultaneous transcriptional activation, transcriptional repression, and genome editing in yeastDepositorInsertCas9-VPR
UseSynthetic BiologyExpressionYeastAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-Nvec-codonopti-Cas9-2xNLS
Plasmid#141108PurposePlasmid containing insert for the IVT of nuclear localized Cas9 mRNA with codon optimization for Nematostella vectensisDepositorInsertNematostella codon optimized Cas9
UseUnspecifiedMutationAll amino acids coded for by codons optimized for…PromoterT7Available SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHBS953 TARDBP-Exon2-ko-sgRNA2-SpCas9
Plasmid#107858PurposeTo knock-out TDP43DepositorInsertgRNA against TARDBP (Exon 2) (TARDBP Human)
ExpressionMammalianAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
rat APOBEC1-EGFP
Plasmid#112857Purposeplasmid for the expression of a rat APOBEC1-EGFP C-terminal fusion proteinDepositorInsertapolipoprotein B mRNA editing enzyme, catalytic polypeptide 1 (Apobec1 Rat)
ExpressionMammalianPromoterCMV promoterAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'UAG)
Plasmid#170128PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_TIMM23_Puro_T2A_BFP2
Plasmid#236731PurposeDual sgRNA targeting TIMM23 expressing BFP with Puromycin selectionDepositorInsertTIMM23 (TIMM23 Human)
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-WT-sgNT
Plasmid#222120PurposeEIF3D overexpression vector with non-targeting sgRNADepositorAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
FB398
Plasmid#203634PurposeModule for the expression of geneticin resistance, Nluc under PgpdA promoter and luciferase under a synthetic promoter containing the target sequence for gRNA1 (1xLuc).DepositorInsertFB367+FB395
UseSynthetic BiologyAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB399
Plasmid#203635PurposeModule for the expression of geneticin resistance, Nluc under PgpdA promoter and luciferase under a synthetic promoter containing two copies of the target sequence for gRNA1 (2xLuc).DepositorInsertFB367+FB396
UseSynthetic BiologyAvailable SinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB400
Plasmid#203636PurposeModule for the expression of geneticin resistance, Nluc under PgpdA promoter and luciferase under a synthetic promoter containing three copies of the target sequence for gRNA1 (3xLuc).DepositorInsertFB367+FB397
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLY227
Plasmid#184148Purposeshort crRNA generator with spacer LEA2 with WT repeat regionDepositorInserts-crRNA-LEA2-WT
UseSynthetic BiologyPromoterPlux2Available SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.108
Plasmid#184977PurposeExpress -Eco1 LYP1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 12
ExpressionYeastMutationLYP1 donor E27stopPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.106
Plasmid#184975PurposeExpress -Eco1 CAN1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, CAN1 G444X, a1/a2 length: 12
ExpressionYeastMutationCAN1 donor G444stopPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.72
Plasmid#184984PurposeExpress Cas9/-Eco1 RT fusion, using linker1DepositorInsertCas9-fusion_linker1-Eco1RT
TagsSV40NLSExpressionYeastMutationhuman codon optimized RTPromoterGal1-10Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only