We narrowed to 31,494 results for: ica;
-
Plasmid#186599PurposeEncodes human full-length Reticulon 2 isoform B fused to GFPDepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pME-GFP-P2A
Plasmid#80807PurposeGFP without stop codon followed by porcine teschovirus-1 2A (P2A) "self-cleaving" peptideDepositorInsertGFP-P2A
Available SinceNov. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
HS-aPKC-CAAX-mKate2
Plasmid#105950Purposeheat shock inducible transgenesisDepositorInsertaPKC-CAAX
TagsmKate2ExpressionBacterialAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHACK(Gal4)-DONR(T2A-LexAGAD)
Plasmid#194769PurposeTo insert T2A-LexAGAD into Gal4 coding sequence in Drosophila, converting Gal4 into a T2A-LexAGAD transgene.DepositorInsertT2A-LexAGAD
UseCRISPRExpressionInsectAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
Gq sensor
Plasmid#137810PurposeA FRET sensor for Gq activation, encoded on a single plasmidDepositorInsertGq sensor
ExpressionMammalianPromoterCMVAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY2-MET-IV
Plasmid#218117PurposeMET-HYGRO plasmid (218133) with the functional cassettes of pY2 (218115) inserted at the sfGFP dropout locus.DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pY2-LYS-IV
Plasmid#218118PurposeLYS-Leu2 plasmid (218114) with the functional cassettes of pY2 (218115) inserted at the sfGFP dropout locus.DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHK316
Plasmid#235474PurposeInducible gene VIII by Ptet promoterDepositorInsertphage M13 geneVIII
ExpressionBacterialAvailable SinceMay 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK352.3
Plasmid#235473PurposeMessage phagemid carrying sgRNA3 (prom. J23110, backbone RSF1030)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM6-T7-VHH72
Plasmid#202487PurposeExpresses the nanobody VHH72 with T7 inductionDepositorInsertnanobody VHH72
Tags6XHisExpressionBacterialPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTK2_005
Plasmid#123700PurposeEncodes pCAG as a Type 2 part to be used in the MTK systemDepositorInsertpCAG
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
Degron-KI SF3B1 donor vector
Plasmid#65622PurposeDonor vector to generate Degron-KI DD-SF3B1DepositorInsertSF3B1 Degron-KI left and right HR arms
Available SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTC150
Plasmid#70014Purpose'Donor only' control plasmid for gene targeting of tomato ANT1 gene. Contains donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral RepliconDepositorInsertDonor + GVR
ExpressionPlantAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-AsCas12j-2
Plasmid#191655PurposeAll-in-one editing CRISPR-Cas construct for one-step genome editing of Streptomyces using AsCas12j-2DepositorInsertAsCas12j-2
ExpressionBacterialPromoterrpsL(XC)-BbsIAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEXP5-NT/pT7 LuxR
Plasmid#193625PurposeConstitutive T7 RNAP-mediated expression of LuxR transcription factor for Lux quorum sensing system. LuxR sequence is codon optimized for E. coli.DepositorInsertLuxR
Tags6xHisExpressionBacterialPromoterT7 RNAP promoterAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCRISPRed pRSETB
Plasmid#159454PurposeExpresses the pH-resistant long Stokes shift red fluorescent protein mCRISPRedDepositorInsertmCRISPRed
Tags10 x His-TagExpressionBacterialPromoterT7Available SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Ace2_D92N_E199V-mNeon
Plasmid#129256PurposeExpress Ace2_D92N_E199V-mNeon in mammalian cellsDepositorInsertAce2_D92N_E199V-mNeon
ExpressionMammalianMutationD92N, E199VPromoterCAGAvailable SinceOct. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 Stu2 1-306
Plasmid#38315DepositorAvailable SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only