We narrowed to 27,383 results for: GFP
-
Plasmid#170865PurposeMammalian expression of His-GFP-Rabphilin.DepositorAvailable sinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLC242-GFP-Sestrin2
Plasmid#100519PurposeExpresses GFP tagged Sestrin2 in mammalian cells to make lentivirusDepositorPublicationAvailable sinceDec. 28, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EGFP-IC2-N106
Plasmid#51411Purposeexpression of GFP-tagged N-terminal AA 1-106 of dynein intermediate chain IC2C in mammalian cellsDepositorAvailable sinceMarch 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-eGFP-hTau-WPRE-pA
Plasmid#255025PurposeLentiviral plasmid designed to express a fusion protein of enhanced GFP and human TauDepositorInsertTau/MAPT (MAPT Human)
UseLentiviralAvailable sinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL1-GFP
Plasmid#67395PurposeMammalian expression of hArl1 with C-term GFP tagDepositorInsertARL1 (ARL1 Human)
TagsGFPExpressionMammalianMutationbp 231 C to T; silent mutationPromoterCMVAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDEST47-ARL6-GFP
Plasmid#67401PurposeMammalian expression of hArl6 with C-term GFP tagDepositorAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-His6-FnCas9GFP
Plasmid#130966Purposeexpression of FnCas9-GFP in bacterial cellsDepositorInsertHA-NLS-FnCas9
UseCRISPRTags6xHis-mEGFP-TEV-HA-NLSExpressionBacterialPromoterT7Available sinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PKAcs-nolinker-GFP
Plasmid#108579PurposeExpresses PKAcs-GFP fusion in mammalian cellsDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
PKAcs-KR6X-GFP
Plasmid#108585PurposeExpresses PKAcs-GFP fusion in mammalian cells with structured linkerDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
PKAcs-G12X-GFP
Plasmid#108588PurposeExpresses PKAcs-GFP fusion in mammalian cells with flexible linkerDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-RAB35
Plasmid#164630PurposeExpresses RAB35 in mammalian cells with a GFP tagDepositorAvailable sinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSETB-de4GFP
Plasmid#85472PurposeInducible expression of dual emitting pH sensitive GFP in bacterial cellsDepositorInsertde4GFP
Tags6xHisExpressionBacterialMutationS65T/C48S/H148C/T203CPromoterT7Available sinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWaldo-GFPd_PepTSt
Plasmid#58333PurposeExpresses the POT family transporter from Streptococcus thermophilus in E. coli as a C-terminally tagged GFP his tagged proteinDepositorInsertPepTSt
TagsGFP-HisExpressionBacterialPromoterT7Available sinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMito-mCherry-FRB_IRES_FKBP(III)-GBPen
Plasmid#128268PurposeBicistronic vector to express mitochondrial targeted mCherry-FRB (MitoTrap) as well as 3x FKBP-GBPenhancer (GFP Nanobody with 3 FKBP domains).DepositorInsertsMitoTrap
FKBP(III)-GBPen
ExpressionMammalianPromoterCMV and IRESAvailable sinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst12-GFP
Plasmid#172311PurposeSST interneuron-restricted gene regulatory element GRE12, to drive GFP expression in SST+ interneuronsDepositorInsertSst12
UseAAVPromoterpB-GlobinAvailable sinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
BCL6-GFP in Artichoke
Plasmid#169931PurposeOverexpression of Full Length of BCL6-GFP fusionDepositorAvailable sinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B N133I
Plasmid#89449PurposeExpression of GFP-tagged human Rab27B N133I in mammalian cellsDepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pProEx-Htb-cytATL2-6Gly-sfGFP
Plasmid#124065PurposeE. coli. exp. and purif. of X. laevis cytATL fragment fused to GFP in c-terminus.DepositorInsertcytATL-sfGFP
TagssfGFPExpressionBacterialPromotertrcAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP1-10-HygR
Plasmid#223675PurposeTo check the split GFP signals in mitochondria (1)DepositorInsertGFP1-10
ExpressionMammalianPromotercmvAvailable sinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only