We narrowed to 16,006 results for: grna
-
Plasmid#250795PurposeDrosophila transgenic vector: nMAGIC vector with tub promoter, 3x HA tags, miRFP680, and HO1. Optimized nMAGIC vector with a far red/infra red FP marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable sinceFeb. 18, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pAAV.U6-sasgRNA(SapI)_Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231367PurposePle155-driven EGFP, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertEGFP
UseAAVAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-mRuby2-W3SL_BbsI(GGA)
Plasmid#231368PurposePle155-driven mRuby2, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertmRuby2
UseAAVAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177360PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expression from Synapsin promoterDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterSynapsine promoter and U6 promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177365PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expressionDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterCMV and U6 promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-inteinC-aa713 SpG C-U6- sgRNA scaffold
Plasmid#208111PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA scaffold by U6 promoterDepositorInsertSpG C, U6, scaffold
UseAAVAvailable sinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-NG C aa714-1368-U6-Lmna sgRNA1
Plasmid#206974PurposeExpresses NG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertNG aa714-1368, U6, Lmna sgRNA1
UseAAVPromoterU6Available sinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1(D908A)-2A-GFP-U6-sgRNA-cloning vector
Plasmid#194726PurposeCAGGS-AsCpf1(D908A)-2A-GFP-U6-sgRNA-cloning vectorDepositorInsertAsCpf1(D908A)
UseCRISPRExpressionMammalianMutationD908AAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA:scaffold tetraloop MS2 aptamer SAM (GB1436)
Plasmid#160570PurposeA version of scaffold sgRNA with the sequence of MS2 aptamer inside the tetraloop of the scaffoldDepositorInsertsgRNA:scaffold tetraloop MS2 aptamer SAM
UseCRISPRMutationBsaI and BsmBI sites removedAvailable sinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-evoSpCas9 (without sgRNA; with silent mutations)
Plasmid#126758PurposeExpression plasmid for human codon-optimized increased fidelity evoSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertevoSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationM495V, Y515N, K526E, R661QPromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-HeFSpCas9 (without sgRNA; with silent mutations)
Plasmid#126759PurposeExpression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertHeFSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-WT_SpCas9 (without sgRNA; with silent mutations)
Plasmid#126753PurposeExpression plasmid for human codon-optimized WT SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertWT SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9 (without sgRNA; with silent mutations)
Plasmid#126754PurposeExpression plasmid for human codon-optimized increased fidelity eSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInserteSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, K1003A, R1060APromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-HypaSpCas9 (without sgRNA; with silent mutations)
Plasmid#126756PurposeExpression plasmid for human codon-optimized increased fidelity HypaSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertHypaSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN692A, M694A, Q695A, H698APromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWS3868
Plasmid#185745PurposeSub-array backbone 4/4DepositorTypeEmpty backboneExpressionYeastAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9 (GB1079)
Plasmid#75399PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusionsDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgEIF4EBP1
Plasmid#128097PurposeCRISPR gRNA against human EIF4EBP1 (4EBP1) with Cas9 from S. pyogenes and 2A-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRISPR sgRNA against human 4EBP1 (EIF4EBP1 Human)
UseCRISPRExpressionMammalianPromoterhU6Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC625
Plasmid#62321PurposesgRNA with 1x MS2, Pol II promoter with ribozyme-gRNA-ribozyme design for yeast cellsDepositorInsertsgRNA +1x MS2, Pol II promoter with ribozyme cleavage
ExpressionYeastPromoterpAdhAvailable sinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNeo/Cre
Plasmid#67594PurposeExpresses an Neomycin-targeting gRNA and Cre-recombinaseDepositorInsertsgNeo
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available sinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by