We narrowed to 14,665 results for: sta
-
Plasmid#162020PurposeExpression of GEF dead IQSEC1 mutantDepositorAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only
-
EGFP-CCHD (p130Cas)
Plasmid#145132PurposeExpresses CCH domain from p130Cas with an EGFP tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertp130Cas CCH domain (BCAR1 Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA2
Plasmid#134642Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRPL26 sgRNA2 (RPL26 Human)
ExpressionMammalianAvailable sinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA1
Plasmid#134641Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRPL26 sgRNA2 (RPL26 Human)
ExpressionMammalianAvailable sinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFSP2 sgRNA2
Plasmid#134637Purposecontains sgRNA targeting human UFSP2 for gene knockoutDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUFSP2 sgRNA2 (UFSP2 Human)
ExpressionMammalianAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px330-UFSP2 sgRNA1
Plasmid#134638Purposecontains sgRNA targeting human UFSP2 for gene knockoutDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUFSP2 sgRNA1 (UFSP2 Human)
ExpressionMammalianAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px458_2A_GFP_sgRNA_RNF138_G1
Plasmid#127120DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA RNF138 (RNF138 Human)
UseCRISPRAvailable sinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
JL302: pMVP/Puro-DEST
Plasmid#121856PurposepMVP destination vector, empty expression vector backbone w/ Puro selection cassetteDepositorTypeEmpty backboneUsePmvp gateway destination vectorExpressionMammalianAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
GHR1 X017_pECIA14
Plasmid#114847PurposePrey vector GHR1 X017_pECIA14 should be used with bait vector GHR1 X017_pECIA2.DepositorAvailable sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
ERECTA C6_pECIA2
Plasmid#115127PurposeBait vector ERECTA C6_pECIA2 should be used with prey vector ERECTA C6_pECIA14.DepositorInsertAT2G26330 (ER Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
P0050::rpaA (KmR)
Plasmid#102321Purposedrives expression of rpaA from an rpaA-independent promoter (kanamycin resistance casette)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRpaA with p0050 promoter (+ kanamycin resistance casette)
UseCloning vectorPromoter-Available sinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-human-BNIP3 delta Exon2
Plasmid#100782PurposeMammalian expression of BNIP3 delta Exon2 splice variantDepositorInserthuman-BNIP3 delta Exon2 (BNIP3 Human)
TagsHAExpressionMammalianMutationExon2 deletionPromoterCMVAvailable sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable sinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_2] (GB1205)
Plasmid#75406PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_2]) of a polycistronic tRNA-gRNA regulated by the dicot U6-26 or U6-1 promoter (3-part multiplexing)DepositorInserttRNA-gRNA
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PBG-WPRE-hGH
Plasmid#74287PurposepAAV vector to express PBG (chimeric Glycoprotein) in a Cre-dependent mannerDepositorInsertPBG (chimeric rabies Glycoprotein)
UseAAVPromoterEf1aAvailable sinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
2.3 hA33 luciferase
Plasmid#68148Purposeluciferase reporter for hA33 promoterDepositorInsertA33 (GPA33 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationstarts at -2270 relative to ATGPromoterhuman GPA33 promoterAvailable sinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-C11orf83-V5
Plasmid#65843PurposeMammalian expression of C terminally V5-tagged C11orf83/UQCC3DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUQCC3 WT (UQCC3 Human)
TagsV5ExpressionMammalianMutationWTAvailable sinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
mOrange2-Keratin-17
Plasmid#57965PurposeNote- This plasmid contains Keratin 18. Localization: Cytokeratin, Excitation: 549, Emission: 565DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertKeratin (KRT18 Human)
TagsmOrange2ExpressionMammalianMutationV282LPromoterCMVAvailable sinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human Mevalonate diphosphate decarboxylase (MDD)
Plasmid#52431Purposebacterial expression of human Mevalonate diphosphate decarboxylase (MDD)DepositorAvailable sinceApril 8, 2014AvailabilityAcademic Institutions and Nonprofits only