2,339 results
-
Plasmid#239799PurposeExpress mEGFP tagged mouse CENPT chimeric protein containing the rat CENPT histone fold domainDepositorInsertMmCENPT--Rn-Histone Fold Domain
UseRetroviralTagsmEGFPExpressionMammalianPromoterMoloney Murine Leukemia Virus (MMLV) LTR promoterAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pALN148
Plasmid#239800PurposeExpress mEGFP tagged mouse CENPT chimeric protein containing the rat CENPT histone fold domain and 4 non-synonymous substitutionsDepositorInsertMm-CENPT-Rn-Histone Fold Domain-4NS
UseRetroviralTagsmEGFPExpressionMammalianMutation4 nucleotide substitution in rat histone fold dom…PromoterMoloney Murine Leukemia Virus (MMLV) LTR promoterAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-PA-BAX(ER, G108V)
Plasmid#233344PurposeStable expression of EGFP-LOV2(N538E)-BAX(G108V)-Cyb5a in mammalian cells. The G108V mutation suppresses pore-forming activity of BAX.DepositorUseRetroviralTagsEGFPExpressionMammalianMutationBAX(3-171), N-terminus and C-terminus are deleted…Available SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-InPGrp
Plasmid#236002PurposeGenetically encoded FRET-based phosphoinositide sensor for monitoring PI(3,4,5)P3. Targeted to lysosome surface.DepositorInsertLyso-InPGrp (Cyth3 Rat, Synthetic)
TagsCerulean, Full-length LAMP1, and cpVenus[E172]ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Endo-InPGrp
Plasmid#236003PurposeGenetically encoded FRET-based phosphoinositide sensor for monitoring PI(3,4,5)P3. Targeted to endosomes.DepositorInsertEndo-InPGrp (Cyth3 Rat, Synthetic)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger), 6xHIS -…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-pA U6 shRNA (Rat NPAS4 #1)
Plasmid#233270PurposeTo express GFP from a CMV promoter and to express and shRNA targeting Rat Npas4DepositorAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-pA U6 shRNA (Rat NPAS4 #5)
Plasmid#233271PurposeTo express GFP from a CMV promoter and to express and shRNA targeting Rat Npas4DepositorAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-pA U6 shRNA (Rat Nurr1 #1)
Plasmid#233273PurposeTo express GFP from a CMV promoter and to express an shRNA targeting Rat Nurr1DepositorInsertGFP and shRNA targeting Rat Nurr1 (Nr4a2 Rat)
UseAAVAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-pA U6 shRNA (Rat Nurr1 #5)
Plasmid#233274PurposeTo express GFP from a CMV promoter and to express an shRNA targeting Rat Nurr1DepositorInsertGFP and shRNA targeting Rat Nurr1 (Nr4a2 Rat)
UseAAVAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDsRed1-CMV-Rat Nurr1-DsRed1-pA
Plasmid#233275PurposeTo Express a Rat Nurr1-DsRed fusion protein from a CMV promoterDepositorAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-pSyn_R-PTEN
Plasmid#227437PurposeExpression of the R-PTEN sensor under the Synapsin promoter in an AAV backboneDepositorInsertR-PTEN sensor (Pten Rat)
UseAAVTagsmCyRFP2 and mMaroonExpressionMammalianMutationR14GPromoterSynapsinAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-W
Plasmid#238064PurposeExpresses rat CENP-W; untagged; made for in vitro transcriptionDepositorAvailable SinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPc1 QFR IP3R3
Plasmid#236454Purposetransient overexpression of IP3R3 in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTK41
Plasmid#236110PurposeExpresses the motor domain of rat KIF5C fused with SNAP tag and ALFA tag nanobodyDepositorInsertsTagsALFA tag nanobody, His tag, SNAP tag, and StrepII…ExpressionBacterialMutationC7S mutation is introduced. 1-430 aa is encoded.PromoterT7Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIC-His6-MBP-TEV-Rgs14
Plasmid#236395PurposeExpresses His6-MBP-TEV-Rgs14 in E. coliDepositorInsertRattus norvegicus regulator of G-protein signaling 14 (Rgs14 Rat)
Tagshexahistidine (H6) tag and maltose-binding protei…ExpressionBacterialAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FLAG-Rgs14
Plasmid#236396PurposeExpresses FLAG-Rgs14 in mammalian cellsDepositorInsertRattus norvegicus regulator of G-protein signaling 14 (Rgs14 Rat)
TagsFLAGExpressionMammalianAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-LOV2-OMP25
Plasmid#233346PurposeStable expression of EGFP-LOV2(N538E)-OMP25 in mammalian cells. This construct lacks BAX domain, and causes no rupture upon photostimulation.DepositorInsertsUseRetroviralTagsEGFPExpressionMammalianMutationN-terminus is deleted and N538EAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_R-PTEN_4A
Plasmid#227435PurposeExpression of the R-PTEN sensor with a 4A mutationDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG_G-PTEN
Plasmid#227436PurposeExpresses the G-PTEN sensor under a CAG promoterDepositorInsertG-PTEN sensor, mEGFP-PTEN-sREACh (Pten Rat)
TagsmEGFP, and sREAChExpressionMammalianMutationR14GPromoterCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLEX-CAG_G-PTEN
Plasmid#227438PurposeAn AAV backbone for expression of the G-PTEN sensor under the CAG promoter, in a Cre dependent manner.DepositorInsertG-PTEN sensor (Pten Rat)
UseAAVTagsCD-sREACh and mEGFPExpressionMammalianMutationR14GPromoterpCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_G-PTEN_4A
Plasmid#227434PurposeExpresses the G-PTEN sensor with a 4A mutationDepositorInsertG-PTEN 4A (Pten Rat)
TagsmEGFP and sREAChExpressionMammalianMutation4A mutation.PromoterCMVAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28 MBP-TEV-Rat BCKDK-His
Plasmid#232119PurposeFor bacterial expression of His-tagged Rat BCKDK (AA31-412, missing precursor peptide) with a cleavable MBP purification tag.DepositorInsertBCKDK (Bckdk Rat)
Tags6 x His, Maltose-Binding Protein (MBP), and Tev S…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAIP4_5HFD
Plasmid#234189PurposeHeterologous protein expression of disks large homolog 4 (PSD-95) (SAP90) in Escherichia coliDepositorAvailable SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAIP4_1EYH
Plasmid#234159PurposeHeterologous protein expression of epsin-1 (EPS-15-interacting protein 1) in Escherichia coliDepositorAvailable SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET28-NFHΔ36-72
Plasmid#232060PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domain lacking residues 36-72DepositorInsertNeurofilament-Heavy tail domain lacking residues 36-72
Tags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFHΔ462-638
Plasmid#232061PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domain lacking residues 462-638DepositorInsertNeurofilament-Heavy tail domain lacking residues 462-638
Tags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFLtail
Plasmid#232055PurposeExpresses construct for surface tethering: R. norvegicus NFL tail domainDepositorInsertNeurofilament-Light tail domain
Tags6xHisExpressionBacterialMutationcDNA codon-optimized for E. coli; added N-termina…PromoterT7Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFMtail
Plasmid#232056PurposeExpresses construct for surface tethering: R. norvegicus NFM tail domainDepositorInsertNeurofilament-Medium tail domain
Tags6xHis, thrombinExpressionBacterialMutationcDNA codon-optimized for E. coli; added N-termina…PromoterT7Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFMshuf1
Plasmid#232058PurposeExpresses construct for surface tethering: R. norvegicus NFM tail domain with more evenly distributed charged residues, sequence 1DepositorInsertNeurofilament-Medium tail domain, charge shuffle 1
Tags6xHis, thrombinExpressionBacterialAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFHtail
Plasmid#232057PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domainDepositorInsertNeurofilament-Heavy tail domain
Tags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFMshuf2
Plasmid#232059PurposeExpresses construct for surface tethering: R. norvegicus NFM tail domain with more evenly distributed charged residues, sequence 2DepositorInsertNeurofilament-Medium tail domain, charge shuffle 2
Tags6xHis, thrombinExpressionBacterialAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUGW-RUSH-LAMP1-mScarleti
Plasmid#228526PurposeLentiviral vector, expresses Strep-KDEL-IRES-SBP-(Rat)LAMP1-mScarleti in mammalian cells.DepositorInsertLAMP1 (Lamp1 Rat)
UseLentiviralTagsStreptavidin Binding Protein (SBP), Streptavidin-…ExpressionMammalianPromoterUbcAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2s-Lysosome-N-20
Plasmid#231770PurposeVisualization of lysosome in mammalian cells using mGold2sDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Kif1A-EGFP-SNAP
Plasmid#229851PurposeKif1A (aa1-351)-Kif1A neck linker(17aa) fused to Kin1 coiled coil (aa345-406)-EGFP-SNAP-his. This Kif1A was used to link an oligo to the motor using the SNAP tag for single molecule experimentsDepositorAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-APOBEC1-EGFP
Plasmid#209324PurposeAAV packaging vector containing a APOBEC1 expression, a P2A-EGFP expression cassette.DepositorInsertAPOBEC1-HA
UseAAVTagsHAAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdnCas3-APOBEC1
Plasmid#229537PurposepMV_hyg encoding dnCas3(H74A+D75A)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
dnCas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-APOBEC1
Plasmid#229536PurposepMV_hyg encoding Cas3(wt)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
Cas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MT2
Plasmid#223330PurposeMapping of cytosol-facing mitochondrion outer membrane proximity proteome by proximity-dependent biotinylation in living Arabidopsis cellsDepositorAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only