We narrowed to 35,340 results for: lat
-
Plasmid#175829PurposeExpress mCherry with microtubule-targeting sequence in mammalian cellsDepositorInsertmCherry with microtuble-targeting sequence
Tagshuman tubulin beta 4B class IVb;TUBB4BExpressionMammalianPromoterCMVAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMEH381 VSV-G MS2 HA
Plasmid#168223PurposeMammalian expression of vesicular stomatitis virus glycoprotein fused to the MS2 dimer and C-terminal HA tagDepositorInsertVSV-G
TagsHA and MS2 dimerExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pScarlessHD-N-3xVHH05-DsRed
Plasmid#171581PurposeFor scarless insertion of 3xVHH05 NanoTag into N-term; Marked by the visible marker 3xP3-DsRed flanked by piggyBac termini.DepositorInsert3xVHH05 (UBE2J1 Human)
ExpressionInsectAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJYDNgp
Plasmid#162453PurposePositive control plasmid for pJYDNg carrying the eUnaG2 bilirubin dependent fluorescent protein fused to the C-terminus of Aga2p protein. This plasmid contains a long 2G linker.DepositorInsertAga2p-2Glinker-eUnaG2 (AGA2 )
UseShuttle vector bacteria/yeastTagsHA nad myc and eUnaG2 fluorescent proteinPromoterGAL1Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJYDN3p
Plasmid#162457PurposePositive control plasmid for pJYDN3n plasmid expression attempts. It contains both eUnaG2 bilirubin dependent fluorescent protein and ALFA-tag for DnbALFA based detection on the cell surface.DepositorInsertAga2p-eUnaG2 (AGA2 )
UseShuttle vector bacteria/yeastTagsALFA tag, HA and myc tags, and eUnaG2 fluorescent…PromoterGAL1Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBluescript II KS(+) ACMV DNA-A 1.4mer
Plasmid#159134PurposeInfectious clone containing a partial-tandem-dimer of African cassava mosaic virus CM:2:98 DNA-ADepositorInsertACMV DNA-A 1.4mer
UseInfectious clone for bombarding plantsAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-FH-Nsp13
Plasmid#157713Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp13 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4.TO-ORF10-2xCSTREP
Plasmid#136174PurposeExpresses C-terminally strep tagged Kaposi's Sarcoma Associated Herpesvirus (KSHV) ORF10DepositorInsertORF10
ExpressionMammalianPromoterCMVAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHM151Env
Plasmid#139017PurposeExpress HIV Env which is isolated a from IRB approved HIV infected patient samples from Singapore and cloned into expression vector (pcDNA 3.1)DepositorInsertHIV-1 Envelope Glycoprotein (env HIV-1)
ExpressionMammalianAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4.TO-ORF45-2xCSTREP
Plasmid#136206PurposeExpresses C-terminally strep tagged Kaposi's Sarcoma Associated Herpesvirus (KSHV) ORF45DepositorInsertORF45
ExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-Myo 1g
Plasmid#134991PurposeExpression of mouse Myo 1g in mammalian cells.DepositorAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEW3: pET-32a Dot1L(2-416)
Plasmid#124098PurposeDot1L(2-416) expression plasmidDepositorAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
hHSF1 K80Q
Plasmid#118351PurposePlasmid expresses hHSF1 with K80 in DBD mutated to Q, which abolish DNA-binding activity of HSF1.DepositorAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Aiolos AA130-189 in Artichoke
Plasmid#74451PurposeMonitor post-translational degradation of Aiolos AA130-189 (Lentiviral, SFFV.AiolosAA130-189-17AARigidLinker-EGFP.IRES.mCherry.cppt.EF1a.PuroR)DepositorAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
JGE302_pAAV-hSyn-DIO-Myc-PYLcs-bArrestin2-YFP (p2)
Plasmid#107247Purposebeta arrestin 2 fused to PYLcs for abscisic acid mediated recruitment of ABIcs labelled proteins.DepositorArticleInsertARRB2
UseAAVTagsMYC, PYLcs, and YFPPromoterhSYNAvailable SinceApril 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
YEp112-CUP1-His-Smt3
Plasmid#99537PurposeYeast episomal vector for expression of His-tagged Smt3 (SUMO); TRP1 markerDepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-2Aneo
Plasmid#80032PurposeUsed to construct AAV-based targeting vectors that carry an IVS-2Aneo cassette for promoter-trappingDepositorTypeEmpty backboneUseAAV and Cre/Lox; A platform vector to construct t…Available SinceAug. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXJ40 GADD34 (Delta Pest1)
Plasmid#78096Purposemammalian expression of GADD34 Delta Pest1DepositorInsertGADD34 (PPP1R15A Human)
TagsFLAGExpressionMammalianMutationdeletion of PEST1PromoterCMVAvailable SinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUG+p97W (C2)
Plasmid#74018Purposelentiviral expression of EGFP-SAP97beta fusionDepositorInsertSAP97 beta isoform
UseLentiviralTagsEGFPExpressionMammalianPromoterhUbCAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only