We narrowed to 12,747 results for: CAR
-
Plasmid#118295PurposeAAV-mediated expression of ChrimsonR-GFP under the CAG promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterCAGAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hAsCas12a(E174R/S542R)-NLS(nucleoplasmin)-3xHA (AAS826)
Plasmid#114091PurposeCAG promoter expression plasmid for human codon optimized AsCas12a(E174R/S542R) nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized AsCas12a (E174R/S542R)
UseTagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationE174R and S542RPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_FLuc_loxP-PuroR
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianMutationPromoterAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Venus1-K49R-STAT3
Plasmid#123166PurposeExpresses K49R STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
UseTagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationK49R substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K49R-STAT3
Plasmid#123167PurposeExpresses K49R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
UseTagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK49R substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus1-K140R-STAT3
Plasmid#123168PurposeExpresses K140R STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
UseTagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationK140R substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K140R-STAT3
Plasmid#123169PurposeExpresses K140R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
UseTagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK140R substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K685R-STAT3
Plasmid#123171PurposeExpresses K695R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
UseTagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK685R substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(5’UTR)-SL-FF
Plasmid#85491PurposeFirefly luciferase under the control of ATP5O 5'UTR followed by a stem-loopDepositorInsert5'UTR of ATP5O followed by stem loop (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationPromoterAvailable sinceJan. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(TISU)-FF
Plasmid#85489PurposeFirefly luciferase under the control of ATP5O TISUDepositorInsertFull TISU element of ATP5O (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutation2nd and 3rd codon of luciferase were modified fro…PromoterAvailable sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLPX-rc [ChrimsonR-GFP]
Plasmid#128588PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α (1.1 kb short version)Available sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.FLAG_NGFR
Plasmid#158240PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.VSVg_NGFR
Plasmid#158246PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.FLAG.VSVg_NGFR
Plasmid#158247PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.FLAG.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.FLAG_NGFR
Plasmid#158251PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.FLAGExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRY2low-tdTomato-Raf1
Plasmid#104176PurposeExpresses fusion of CRY2low mutant (CRY2 aa1-491 R489E A491D) with tdTomato and Raf1DepositorUseTagsExpressionMammalianMutationCRY2 aa 1-491 truncation, R489E A491DPromoterCMVAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(BsmBI)-EF1a-BFP-BSD-Dmap1(SDM)
Plasmid#117139PurposeExpression vector encoding BFP-BSD-HA-Dmap1 resistant against gRNA encoded by pKLV2-U6(gDmap1 v4)--PGK-Puro-BFPDepositorInsertHA-Dmap1 (mutagenised) (Dmap1 Synthetic)
UseLentiviralTagsHAExpressionMammalianMutationmodified BFP, modified Dmap1 CDSPromoterhuman U6 promoter, human EF1a promoterAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-6
Plasmid#122232PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only