We narrowed to 16,007 results for: grna
-
Plasmid#60901PurposeDual Expression Vector for FokI-dCas9 and gRNADepositorTypeEmpty backboneUseCRISPRTags3XFLAGExpressionMammalianPromoterCBh and U6Available sinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pX330-PITCh-H2BC11
Plasmid#207755PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of H2BC11 for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting C-terminus of H2BC11 (H2BC11 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-fabI-gltA1-gltA2-udhA-zwf-gapAP1
Plasmid#87149PurposefabI-gltA1-gltA2-udhA-zwf-gapAP1 targeting guide RNA E. coli, Low Phosphate InductionDepositorInsertfabI-gltA1-gltA2-udhA-zwf-gapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available sinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGMV-U
Plasmid#112797PurposeUniversal BeYDV-derived vector for cloning of up to four gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEE391
Plasmid#149281PurposeT-DNA encoding TRV2 with FT augmented gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA_FT:tNos
ExpressionPlantPromoter35SAvailable sinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB3405
Plasmid#106166PurposeEasyCloneYALI system-based yeast episomal vector carrying a nourseothricin-resistance marker for Yarrowia lipolytica, can be used for gRNA expression, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJAT31
Plasmid#204291PurposeFor inserting a phiC31 attP site. HDR integrant is marked with ie1-DsRed, which is expressed in abdomen and mouthparts. Second U6 promoter allows use of two different gRNAs in two synthesized arms.DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertie1-DsRed
UseCRISPRPromoterie1Available sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX335-NEAT1_IS_v2
Plasmid#97086PurposeEncodes an sgRNA that creates a SSB near the poly(A) site of human NEAT1_1 isoform.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA NEAT1_IS_v2
UseCRISPRPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335-NEAT1_IS_v1
Plasmid#97085PurposeEncodes an sgRNA that creates a SSB near the poly(A) site of human NEAT1_1 isoform.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA NEAT1_IS_v1
UseCRISPRPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-tracr-U6-crRNA(tdTomato)-NLS-NmCas9-HA-NLS(s)
Plasmid#47869PurposeAll-in-one plasmid targeting tdTomatoDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsNmCas9
U6pr-tracrRNA
tdTomato crRNA
UseCRISPRTagsHA and NLSExpressionMammalianAvailable sinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330A_D10A-1x5
Plasmid#58775PurposeExpresses Cas9 nickase and gRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTags3xFLAGExpressionMammalianMutationD10A nickase-converting mutationPromoterCBhAvailable sinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAC-U61-SapI
Plasmid#112808PurposegRNA cloning vector for expressing 1-3 gRNAs in DrosophilaDepositorTypeEmpty backboneExpressionBacterialAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable sinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available sinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-PITCh-TUBA1B
Plasmid#207763PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of TUBA1B for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting N-terminus of TUBA1B (TUBA1B Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJA54
Plasmid#60212Purposecleavage near e1350 locus in sqt-1DepositorInsertsqt-1(e1350) gRNA1
UseCRISPRPromoterU6Available sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
U6>Control(F+E)
Plasmid#60006PurposeU6 promoter driving control (F+E) sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertControl (F+E) sgRNA
UseCRISPRPromoterCiinte.U6Available sinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ERF922
Plasmid#126883PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only