We narrowed to 15,275 results for: grn
-
Plasmid#91212Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters, structurally optimized gRNA scaffolds)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC363
Plasmid#91211Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtU6 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC303
Plasmid#91210Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (AtU6 and AtSL7 promoters)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC441
Plasmid#91218Purposeprotoplast vector for targeted deletion of MLO gene in barley (PvUbi1 promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC437
Plasmid#91219Purposeprotoplast vector for targeted deletion of MLO gene in barley (CmYLCV promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-SpCas9-HF1-plus
Plasmid#126775PurposeExpression of increased fidelity SpCas9-HF1-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1.DepositorInsertSpCas9-HF1-plus
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationN497A; Q695A; Q926A; amino acids 1005-1013 replac…PromoterT7Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-PtW-eSpCas9
Plasmid#133357PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserteSpCas9
TagsHA-tagged eSpCas9ExpressionMammalianMutationeSpCas9 mutationsPromoterCMV enhancer and hEf1a (CpG free)Available sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-UBE2G1 sg2R-P2A-Hygro
Plasmid#124299PurposeLentiviral vector for expression of Flag tagged UBE2G1-P2A-Hygro casette from a CMV promoter. UBE2G1 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertUBE2G1 (UBE2G1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-U6-shHMGA2.2-PGK-dTomato
Plasmid#89605PurposeSilencing Hmga2 in human cellsDepositorAvailable sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGRT-Fc(DAPA)-AviTag-6xHis
Plasmid#156820PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCGRT (FCGRT Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaMyosin binding domain
Plasmid#187275PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Myosin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaMyosin binding domainPromoterU6, CMVAvailable sinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Gnaq
Plasmid#170298PurposeEncoding mouse GnaqDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertA recombinant mouse Gnaq (Gnaq Mouse)
TagsN/AExpressionMammalianMutationAsilent mutation was introduced into the sgRNA-ta…Available sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-BtW-eSpCas9
Plasmid#133358PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserteSpCas9
TagsFlag-tagged eSpCas9ExpressionMammalianMutationeSpCas9 mutationsPromoterCMV enhancer and hEf1a (CpG free)Available sinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry TFRC_B
Plasmid#78544PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDECKO-mCherry MALAT1_Exon.4
Plasmid#78543PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.2
Plasmid#78541PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTR(EF)-tRNA(Q)
Plasmid#170517PurposePCR template vector for amplifying gRNAcore(EF)-tRNA(Q) fragment; used together with pAC-U63-tgRNA-nlsBFP or pAC-U63-tgRNA-Gal80DepositorInsertgRNAcore(EF)-tRNA(Q)
UsePcr template vector for amplifying grnacore(ef)-t…Available sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only