We narrowed to 19,308 results for: Tat
-
Plasmid#229619PurposeMammalian expression of full length mouse FoxP3 (R337Q, A372S)DepositorInsertfull length FoxP3, carrying double mutation R337Q/A372S (Foxp3 Mouse)
ExpressionMammalianMutationR337Q/A372SAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCHW100002
Plasmid#222440PurposeLevel 0, CDS module (AATG-GCTT) containing rice OsL5.DepositorInsertOsL5 (Oryza sativa)
UseSynthetic BiologyExpressionPlantMutationBsaI/BbsI sites removed by point-mutationAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4542
Plasmid#215261PurposeModule for the expression of the N. nambi HISPS gene under the regulation of the copper inducible CBS4x:mDFR promoter and TNOS and the constitutve expression of CPH, LUZ, H3H, EGFP and p19DepositorInsertCBS4x:mDFR:HISPS-SF-CPH-SF-LUZ-H3H-EGFP-p19
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQA-LP574
Plasmid#222953PurposeExpresses R120A LoaPDepositorInsertantiterminator protein LoaP
Tags10xHIS-SUMOExpressionBacterialMutationmutated Arginine 120 to AlaninePromoterT7Available SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mTagBFP2 rat DJ-1 shRNA
Plasmid#222870PurposeExpresses mTagBFP2 along with an shRNA against rat DJ-1DepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-UBC_NKX2-1
Plasmid#221495PurposeNKX2-1 short isoform lentiviral overexpression using UBC promoterDepositorAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-hPGK_NKX2-1
Plasmid#221494PurposeNKX2-1 short isoform lentiviral overexpression using hPGK promoterDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4401
Plasmid#215252PurposeModule for the expression of the N. nambi HISPS gene under the regulation of PNOS and TNOS and the constitutive expression of CPH, LUZ, H3H, EGFP and p19.DepositorInsertSF-PNOS:HISPS:TNOS-CPH-LUZ-H3H-EGFP-p19
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS4
Plasmid#218713PurposeExpresses N-terminally EGFP-tagged BBS4 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPbHiT_3xmyc_hsp70UTR_hdhfr/yfcu
Plasmid#216421PurposeEmpty backbone to express gene specific gRNA and carry the homology repair template for CRISPR editing of Plasmodium berghei using the PbHiT system.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiTags3xmycExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu
Plasmid#216422PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-Sec61B
Plasmid#207553PurposeHomologous recombination donor to integrate and expression cassette for EGFP-Sec61B in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-Sec61B
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AID-C12*-BE4max
Plasmid#216729PurposeExpresses a BE4max base editing construct comprised of the hyperactive AID-C12* and nCas9 (Cas9 with D10A mutation) in mammalian cells.DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT3_mCherry2-NLS-PEST_Puro
Plasmid#213771PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT3_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EFS_mCherry2-NLS-PEST_Puro
Plasmid#213775PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertEFS_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
p164-pAAV-mDlx-FLEX-mScarlet
Plasmid#204689PurposeFluorescent reporter under the control of the Dlx promotorDepositorInsertmScarlet
UseAAV and Cre/LoxTagsmScarlet palmitoylationExpressionMammalianPromotermDlxAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-ACSL4-FL
Plasmid#202515PurposeExpressing luciferase driven by human ACSL4 promoter (bases -1 to -2844 with respect to exon1 start site)DepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
tetO-MESP1
Plasmid#170694Purposedoxycycline-inducible overexpression of MESP1DepositorInsertMESP1 (MESP1 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only