We narrowed to 24,790 results for: SPR
-
Plasmid#215863PurposeThis plasmid encodes sgRNA that target Renilla luciferase with stretch sequenceDepositorInsertsgRNA-RL554 with TTTA stretch
UseRetroviralExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-62
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-CASPR/Neurexin IV [K65A/2R]
Plasmid#206605PurposeMammalian Expression Plasmid of anti-CASPR/Neurexin IV (Rat). Derived from hybridoma K65A/2.DepositorInsertanti-CASPR/Neurexin IV (Rattus norvegicus) recombinant mouse monoclonal antibody
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-2 lentiCRISPR v2 plasmid
Plasmid#192232Purposelentiviral vector expressing sgRNA-2 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-2 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-1 lentiCRISPR v2 plasmid
Plasmid#192231Purposelentiviral vector expressing sgRNA-1 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-1 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-2 lentiCRISPR v2 plasmid
Plasmid#192228Purposelentiviral vector expressing sgRNA-2 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-2 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-1 lentiCRISPR v2 plasmid
Plasmid#192227Purposelentiviral vector expressing sgRNA-1 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-1 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO5-SgHottip-GFP-CRISPRi
Plasmid#134989PurposedCas9-mediated inactivation of HOTTIP in mammalian cellsDepositorAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone2
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone3
Plasmid#162124PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFS_0362_pET30-RT-CRISPR_Candidatus_Accumulibacter_sp._BA-91_ARRAY_1
Plasmid#116974PurposeExpresses CaBA-91RT-Cas1-Cas2 under pT7lac promoter, encodes CaCRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertCandidatus Accumulibacter sp. BA-91 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0356_pET30-RT-CRISPR_Candidatus_Accumulibacter_sp._SK-02_ARRAY_1_RC
Plasmid#116968PurposeExpresses CaSK-02RT-Cas1-Cas2 under pT7lac promoter, encodes CaCRISPR array 1 RC, compatible with SENECA acquisition readoutDepositorInsertCandidatus Accumulibacter sp. SK-02 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0355_pET30-RT-CRISPR_Candidatus_Accumulibacter_sp._SK-02_ARRAY_1
Plasmid#116967PurposeExpresses CaSK-02RT-Cas1-Cas2 under pT7lac promoter, encodes CaCRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertCandidatus Accumulibacter sp. SK-02 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
R777-E326 Hs.SPRED3-nostop
Plasmid#70610PurposeGateway ORF clone of human SPRED3 [NM_001042522.2] without stop codon (for C-terminal fusions)DepositorInsertSPRED3 (SPRED3 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpRY-P2A-EGFP (RTW4830)
Plasmid#139989PurposeCMV and T7 promoter expression plasmid for human codon optimized SpRY(A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpRY with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N131…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-CRISPRoffv2.1-IRES-BlastR
Plasmid#207180PurposeLentiviral Expression Plasmid for CRISPRoff2.1 driven by EF1a PromoterDepositorInsertCRISPRoffv2.1
UseCRISPR and LentiviralTagsHA and TagBFPExpressionMammalianPromoterEF1aAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX097-U6-SpTracrRNA-EF1a-hSpRNaseIII-mCherry
Plasmid#41863PurposeThis plasmid is used to reconstitute the complete Type II CRISPR system from S. pyogenes and contains the host factor RNaseIII and tracrRNA.DepositorArticleInsertU6-SpTracrRNA-EF1a-hSpRNaseIII-mCherry
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only