We narrowed to 1,456 results for: U6 promoter
-
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRTagsExpressionMutationPromoterhUAvailable sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1pr_v1
Plasmid#97081PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v1
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1pr_v2
Plasmid#97082PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v2
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-GFP-SFPQ
Plasmid#97084PurposeEncodes an sgRNA that creates a DSB at the promoter of human SFPQ gene.DepositorInsertsgRNA GFP-SFPQ
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
OA-1050G (white)
Plasmid#132420Purposeexpress arrays of gRNA targeting White under dU6-3 promoterDepositorInsertwhite gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050J (GFP)
Plasmid#133304Purposeexpress arrays of gRNA targeting GFP under dU6-3 promoterDepositorInsertGFP gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF824_U6-Sau-sgRNA-EF1a-mCherry2_lenti
Plasmid#138318PurposeLenti expression of mCherry2 with U6 promoter for SauCas9 sgRNA targeting GFPDepositorInsertSauCas9 GFP sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF820_U6-sgRNA-EF1a-mCherry2_lenti
Plasmid#138316PurposeLenti expression of mCherry2 with U6 promoter for SpyCas9 sgRNA targeting GFPDepositorInsertSpyCas9 GFP sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050K (firefly luciferase)
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050V (wingless)
Plasmid#132424Purposeexpress arrays of gRNA targeting Wingless under dU6-3 promoterDepositorInsertwingless gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050Z4 (yellow)
Plasmid#132425Purposeexpress arrays of gRNA targeting Yellow under dU6-3 promoterDepositorInsertyellow gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cdk12_intron3_sg2_pX330
Plasmid#127174PurposesgRNA that cuts within intron 3 of mouse Cdk12 genomic locus in pX330 backboneDepositorInsertMouse Cdk12 Intron 3 sgRNA
UseCRISPR and Mouse TargetingTagsExpressionMutationPromoterU6 PromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
Cdk12_intron4_sg1_pX458
Plasmid#127175PurposesgRNA that cuts within intron 4 of mouse CDK12 genomic locus in pX458 backboneDepositorInsertMouse Cdk12 Intron 4 sgRNA
UseCRISPR and Mouse TargetingTagsExpressionMutationPromoterU6 PromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3+1T>A_(PP7-C4-Q1)
Plasmid#232437PurposepegRNA with optimized 3' modifications to facilitate a +1 T to A prime edit in the HEK3 locusDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-mU6gRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#72667PurposeLentiviral dual CRISPR gRNA expression vector (mouse U6 and human U6 promoters)DepositorInsertmU6gRNA cassette, hU6gRNA cassette, PGKpuroBFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_B2M_sgRNA(PP7)
Plasmid#232438PurposesgRNA to facilitate a splice donor site disruption via adenine base editing in the B2M locus, contains a PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged gRNA for B2M disruption via splice donor consensus disruption via ABE8e or Cas9 driven by human U6 promoter
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-dTomato
Plasmid#99376PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A dTomato from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-dTomato
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1a and hU6Available sinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1a and hU6Available sinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only