We narrowed to 14,219 results for: CAR
-
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1delta
Plasmid#124150PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1beta
Plasmid#124140PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Pet28a His6-HSPB7 (zebrafish) C49S
Plasmid#110071PurposeExpress C49S mutant of Zebrafish His6-HSPB7 in bacteriaDepositorInsertHis6-HSPB7 (hspb7 Zebrafish)
TagsHis6ExpressionBacterialMutationCysteine 49 to SerinePromoterT7Available SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP134 [pRS406-YBR139Wp-YBR139W(S219,D415,H474A)-GFP-ADH1t]
Plasmid#106469PurposeExpresses Atg42/Ybr139w(S219,D415,H474A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(S219,D415,H474A)
TagsGFPExpressionBacterial and YeastMutationChanged Serine 219, Aspartate 415 and Histidine 4…PromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEHISSSO6206
Plasmid#97065PurposeExpressing Sulfolobus solfataricus orf SSO6206 proteinDepositorInsertS. solfataricus orf SSO6206
TagsN-terminal TEV protease cleavable 6xHis tagMutationnonePromoterT7Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
TNNI3K gRNA (BRDN0001487146)
Plasmid#77896Purpose3rd generation lentiviral gRNA plasmid targeting human TNNI3KDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TNNI3K gRNA (BRDN0001146965)
Plasmid#77897Purpose3rd generation lentiviral gRNA plasmid targeting human TNNI3KDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TNNI3K gRNA (BRDN0001147407)
Plasmid#77898Purpose3rd generation lentiviral gRNA plasmid targeting human TNNI3KDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV5b HA Irx5 deltaIrot
Plasmid#24995DepositorInsertIrx5 (Irx5 Mouse)
TagsHAExpressionMammalianMutationDeletion of Iro box (aa 314-327), 19 aa upstream …Available SinceAug. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV5b HA Irx5 deltaC
Plasmid#24996DepositorInsertIrx5 (Irx5 Mouse)
TagsHAExpressionMammalianMutationDeletes everything after Hox Domain (aa 112-177).…Available SinceAug. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMS22H-IRE
Plasmid#133905PurposePositive control when used in combination with pAWH-IRP. Expression of MS2BS-IRE site hybrid. Homology regions for recombination with pAWHDepositorAvailabilityAcademic Institutions and Nonprofits only