We narrowed to 5,098 results for: Mos
-
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCK306
Plasmid#110544PurposerhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.DepositorInsertsPrhaBAD
yfp
rhaS
ExpressionBacterialPromoterN/A, PrhaBAD, and kanR promoter (upstream of kanR…Available SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP4
Plasmid#129507PurposeExpresses AvicFP4 constitutively in E. coli (most strains)DepositorInsertAvicFP4
ExpressionBacterialMutationOne of two variants of AvicFP4 tested with essent…Promotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNMSB104
Plasmid#199314PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB84
Plasmid#199309PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elega…Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-linker-TlcnC
Plasmid#114377Purposeexpresses Flpo recombinase-dependent GtACR2-Kv2.1C-linker-TlcnC, which targets GtACR2 to the somatodendritic compartment. Messier et al found this hybrid construct was the most effective at targetingDepositorInsertGtACR2-EYFP-Kv2.1C-linker-TlcnC (NEWENTRY )
UseAAVTagsEYFP and Kv2.1C-linker-TlcnCExpressionMammalianPromoterEf1aAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -