We narrowed to 171 results for: Hrg
-
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger1-TS-YFP)
Plasmid#127245PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger1) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger1-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianMutationPromoterCAGAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger3-TS-YFP)
Plasmid#127242PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger3) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger3-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianMutationPromoterCAGAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTag4C_Nrg1-GV-2HA
Plasmid#227104PurposeNrg1 protein for luciferase and barcode assaysDepositorInsertNrg1-GV (Nrg1 Mouse)
UseTags2xHAExpressionMammalianMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hNRG1a
Plasmid#199235PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorInsertNeuregulin (NRG1 Human)
UseTagsTrxA-6xHis-S-tagExpressionBacterialMutationPromoterT7Available sinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-NRG1-ScNeo
Plasmid#209900PurposeTo monitor the status of NRG1, the plasmid encodes a recombinant NRG1 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertNRG1-ScNeo (NRG1 Human)
UseLentiviralTagsmNeonGreen and mScarletExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG NBT:NRGIIIa:polyA
Plasmid#193012PurposeTol2 transgenic construct that will express human Neuregulin1 Type IIIa in neuronsDepositorInsertsUseTransposon transgenesisTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-NRG1-ScNeo
Plasmid#209911PurposeTo monitor the status of NRG1, the plasmid encodes a recombinant NRG1 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertNRG1-ScNeo (NRG1 Human)
UseTagsmNeonGreen and mScarletExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-NRG1-ScNeo
Plasmid#209906PurposeTo monitor the status of NRG1, the plasmid encodes a recombinant NRG1 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertNRG1-ScNeo (NRG1 Human)
UseTagsmNeonGreen and mScarletExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only