We narrowed to 13,578 results for: sequence
-
Plasmid#221592PurposeExpresses the palmitoylation sequence, the ciliary targeting sequence of mammalian Arl13b (amino acids 347-363) and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationdeleted amino acid 10-346,364-428PromoterCMV promoterAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PAL-AA347-363-RVEP-4A-GFP
Plasmid#221593PurposeExpresses the palmitoylation sequence, the ciliary targeting sequence with RVEP4A mutation of mammalian Arl13b (amino acids 347-363) and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationdeleted amino acid 10-346 and 364-428, changed RV…PromoterCMV promoterAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
eft-3p:act-5(ptc):tbb2 3' UTR
Plasmid#202331PurposeThe ubiquitous eft-3 promoter drives overexpression of the mutant act-5(ptc) gene including introns.DepositorInsertseft-3 promoter
act-5(ptc)
tbb-2 3' UTR
Tagsbase 238 C -> A mutation causing a PTC at codo…ExpressionWormPromoterThis is a promoter sequence for C. elegans eft-3,…Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPK-352
Plasmid#157922PurposepcDNA-CMV-PCYA-IRES-HO1-P2A-FD-P2A-FNRDepositorInsertstPcyA
IRES
HO1
FD
FNR
UseSynthetic Biology; OptogeneticsTagsMitochondrial Targeting Sequence, Mitochondrial T…ExpressionMammalianPromoterCMVAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_HR_Prnp_3
Plasmid#78621PurposepX330 vector encoding SpCas9 and a chimeric guide RNA targeting Prnp coding sequenceDepositorInsertpX330_HR_Prnp_3
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6Available SinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-hLRP6-opt(20-1613)-9xHis_MESD_pFastBacDual
Plasmid#216377PurposeBaculovirus transfer vector to co-express FLAG-LRP6-His (human sequence, codon-optimized for insect cell expression) and MESD chaperone (human sequence)DepositorInsertLDL receptor related protein 6 (LRP6 Human)
UseBaculovirusTags9xHis and HA signal sequence-FLAG-3C cleavage sit…ExpressionInsectPromoterPolyhedrin (LRP6)/p10 (MESD)Available SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
p210 pCMV-CREM
Plasmid#8395PurposeCre with chimeric/β-globin intron within the Cre coding sequenceDepositorInsertCREM
UseCre/LoxExpressionMammalianMutationmodified CrePromoterCMVAvailable SinceJuly 18, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLSLGUS
Plasmid#51517PurposepLSL with GUS coding sequence followed by 3 kb of filler sequence Rep is not included on this plasmidDepositorInsertsGUS
3kb filler sequence
UsePlant t-dna plasmidTagsNLS and flagPromotervirion-sense LIR and 2x35SAvailable SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-EGFP
Plasmid#196606PurposeDual-Luciferase Reporter vector carrying an EGFP direct sequenceDepositorInsertGFP
ExpressionMammalianAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
C79m
Plasmid#120991PurposeMoClo golden gate assembly CD part for ccdA (Antitoxin to ccdB/C39m. Sequence taken from pMAR7 plasmid sequence). Please see Supplemental Documents for annotated Genbank file.DepositorInsertccdA antitoxin
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCCG_nit9fl
Plasmid#228409PurposeExpression of NIT-9 in N. crassa at the his-3 locusDepositorInsertNIT-9
UseProtein expression in n. crassaAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Ef1a_FLEX_mAPEX2_P2A_mRuby2
Plasmid#171938PurposeExpresses membrane targeted (palmitoylation) APEX2 and mRuby2 as separate proteinsDepositorInsertApex2, mRuby2
UseAAV and Cre/LoxExpressionMammalianPromoterEf1aAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_FLEX_tau-APEX2
Plasmid#171937PurposeExpresses APEX2 linked to tau for labeling microtubulesDepositorInserttau-APEX2
UseAAV and Cre/LoxExpressionMammalianPromoterhsynAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry_C1_miR21
Plasmid#65970PurposeExpressed mCherry under the control of miR-21 (miR-21 complementary sequence in 3' UTR)DepositorInsertmiR-21 complementary sequence
ExpressionMammalianPromoterCMVAvailable SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Efla_FLEX_APEX2-eGFPf
Plasmid#171939PurposeExpresses a membrane targeted (farnesylation) APEX2-eGFP fusion proteinDepositorInsertAPEX2-eGFPf
UseAAV and Cre/LoxExpressionMammalianPromoterEf1aAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCG_nit9_without_linker
Plasmid#228411PurposeExpression of NIT-9 without linkage region in N. crassa at the his-3 locusDepositorInsertNIT-9
UseProtein expression in n. crassaMutationdeletion of the linkage regionAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCCG_nit9fl_reverse
Plasmid#228410PurposeExpression of NIT-9 with reversed domains in N. crassa at the his-3 locusDepositorInsertNIT-9 domains reversed
UseProtein expression in n. crassaMutationdomains reorientedAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCARS1
Plasmid#174868PurposeContains TEF1p-TEF1in-hGFP-CYCt cassette and wildtype ARS1DepositorInsertARS1
UseSynthetic BiologyExpressionBacterial and YeastAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGrDL_SPb
Plasmid#83205Purposereceives miRNA target sequences for testing using the dual luciferase assay systemDepositorInsertTomato ACTIN promoter
ExpressionPlantPromoterTomato ACTINAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS84 (U6p::GGACAGTCCTGCCGAGGTGG)
Plasmid#193852PurposeEncodes the guide RNA targeting the sequence GGACAGTCCTGCCGAGGTGGDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only