We narrowed to 16,181 results for: nes
-
Plasmid#54444DepositorInsertCPK17-N-terminal + NES for enhanced export
UseCloning vectorAvailable sinceJune 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
myc-actin-NES-1
Plasmid#60618PurposeEncodes MYC tagged beta-actin with a mutation in the NESDepositorAvailable sinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCI5-CasRx-NES-HA (pKW387)
Plasmid#229048PurposeMammalian expression of CasRx-NES-HADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCasRx (RfxCas13d)
UseCRISPRTagsNES-HAExpressionMammalianAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-NES-Myc(340-439)-GFP-IRES-mCherry (NES-DBD)
Plasmid#231237PurposeMYC stability reporter construct of the DNA-binding-domain (residues 340-439) fused to an N-terminal NES for transient expression in mammalian cellsDepositorInsertMYC (MYC Human)
ExpressionMammalianMutationNES fused to the DNA-binding-domain of MYC (resid…Available sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNESx2-EGFP-C1-PABDx2-Spo20
Plasmid#220082PurposePA biosensor with tandem Spo20-PABDs and two NES domains to aid in nuclear exportDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpo20 (SPO20 Budding Yeast)
TagsX. leavis map2k1.L(32-44)-GGSG-X. leavis map2k1.L…ExpressionMammalianMutationamino acids 51-91, tandem dimerPromoterCMVAvailable sinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-RasAR(R89L)-NES
Plasmid#205568PurposeRasAR negative-control mutant plasmid. Targeted to cytosol.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRasAR(R89L)-NES (RAF1 Human, Synthetic)
TagsNuclear export signal (NES)ExpressionMammalianMutationArg 89 mutated to Leu in Raf1 RBD region.PromoterCMVAvailable sinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ17940-PHR-SFFV-NES*3-PYL1-pHintein_N150-NLS-ABE8e-Cas9-NLS
Plasmid#252646PurposeHuman expression vector containing SFFV promoter, ABE8e fused to PYL1 and pH inteinDepositorInsertNES*3-PYL1-pHintein_N150-NLS-ABE8e-Cas9-NLS
UseLentiviralPromoterSFFVAvailable sinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-NES-ZapCmR1.1
Plasmid#59014PurposeCytosolic zinc-binding FRET biosensorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNES-ZapCmR1.1 genetically encoded cytosolic Zn(II) sensor
TagsNuclear Exclusion SignalExpressionMammalianMutationSee commentPromoterCMVAvailable sinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ERKsub(TA)DD-Venus-NES
Plasmid#84631PurposeEncodes negative-control C-terminal (substrate) fragment of bimolecular ERK activity reporter (bimEKAR); cytosol targetedDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertERKsub(TA)DD-Venus-NES
Tags6xHis, Nuclear export signal (NES), T7 tag (gene …ExpressionMammalianMutationMutated target Thr residue to Ala.PromoterCMVAvailable sinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
LI B-C N-NES KOZ b c7
Plasmid#54445DepositorInsertNuclear Export Signal (NES) of heat stable inhibitor (PKI)
UseCloning vectorAvailable sinceJune 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
ARB344
Plasmid#124027PurposeEncodes TU with connectors L1 R2 and an B1 insulator, and pCMV expressing cytoplasmic iRFP713DepositorInsertL1-B1_CMV-NES::iRFP713-rglPA_R2
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB345
Plasmid#124028PurposeEncodes TU with connectors L1 R2 and an B1 insulator, and pCMV expressing cytoplasmic tagBFPDepositorInsertL1-B1_CMV-NES::tagBFP-rglPA_R2
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB346
Plasmid#124029PurposeEncodes TU with connectors L1 R2 and an B1 insulator, and pCMV expressing cytoplasmic mAzamiGreenDepositorInsertL1-B1_CMV-NES::mAzamiGreen-rglPA_R2
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB347
Plasmid#124030PurposeEncodes TU with connectors L1 R2 and an B1 insulator, and pCMV expressing cytoplasmic mRuby2DepositorInsertL1-B1_CMV-NES::mRuby2-rglPA_R2
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII_NES-his-CaMPARI2-F391W-WPRE-SV40
Plasmid#163698PurposeAAV vector expressing CaMPARI2_F391W primarily in excitatory neurons in rodent cortexDepositorInsertCaMKII_NES-his-CaMPARI2-F391W-WPRE-SV40
UseAAVTagsFLAG-HA-myc and NES_hisExpressionMammalianPromoterCaMKII fragmentAvailable sinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDN34
Plasmid#61343PurposemCherry fused to LINuS, a light-inducible nuclear localization signal (biNLS2/PKIt NES)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry
TagsGS linker-AsLov2-biNLS2 and PKIt NESExpressionMammalianPromoterCMVAvailable sinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
nCaMK2rep
Plasmid#239624PurposeCaMKII activity reporter. The lentiviral plasmid contains a nanobody sequence (PSD95.FingR), 3xmyc tags and double phospho-site 3 from rat Synapsin-1a.DepositorInsertPSD95.FingR-NES-SynP3-3xmyc (Syn1 Synthetic, Rat)
UseCre/Lox and LentiviralTagsFlag and mycExpressionMammalianPromoterhSynAvailable sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
nCaMK2rep-S603A
Plasmid#239625PurposeInactive CaMKII activity reporter. The lentiviral plasmid contains a nanobody sequence (PSD95.FingR), 3xmyc tags and double mutated phospho-site 3 from rat Synapsin-1a.DepositorInsertPSD95.FingR-NES-SynP3-3xmyc (Syn1 Synthetic, Rat)
UseCre/Lox and LentiviralTagsFlag and mycExpressionMammalianMutationChanged serine 603 to AlaninePromoterhSynAvailable sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ratiometric FPX sensor for ERK kinase activity
Plasmid#60974PurposeFor imaging of ERK kinase activity using a single polypeptide RA-WW domain-ERK substrate-B protein and free GA-NES.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertddRFP A-WW domain-ERK substrate-ddFP B
TagsERK substrate is before ddFP copy B, WW domain is…ExpressionMammalianPromoterCMVAvailable sinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by