We narrowed to 13,735 results for: 109
-
Plasmid#112709PurposeExpresses N-terminally GST-tagged human RNMT in bacterial cellsDepositorAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pCW57.1-pDUXCca
Plasmid#198236PurposeLentivector with tet-inducible porcine DUXC (codon altered)DepositorInsertporcine DUXC (codon altered)
UseLentiviralExpressionMammalianMutationcodon alteredPromoterTREAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
AsCas12a-DR-cr in PBCSK-
Plasmid#126640PurposeCloning vector AsCas12a DR-crRNA for expression in mammalian cellsDepositorInsertAsCas12a Full Length Direct Repeat crRNA
UseCRISPRExpressionMammalianPromoterU6 PromoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFPm-DAD
Plasmid#25410DepositorInsertDiap3 (Diaph3 Mouse)
TagsEGFP, His, and MycExpressionMammalianMutationmDia2 Amino Acids 1031-1171; Q1091P mutationAvailable SinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
Fuw CBX8 dCD
Plasmid#121117Purposeconditional expressionDepositorAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
Fuw CBX8 3xRA
Plasmid#121115Purposeconditional expressionDepositorAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5099
Plasmid#128714PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopK1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5328
Plasmid#128721PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopU1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5306
Plasmid#128712PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopH1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5571
Plasmid#128713PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopI1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5539
Plasmid#128728PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopAF1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5618
Plasmid#128709PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopE1
ExpressionBacterialAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCPP5617
Plasmid#128706PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopB1
ExpressionBacterialAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPO717
Plasmid#195302PurposepBAD322-MycaIDCas-lacZsp5, arapBAD promoter expressing type I-D Cascade and one spacer array of McCAST (Tn7575), the single spacer is lacZ spacer 5.DepositorInsertMcCAST Cascade and lacZ spacer 5 in native array
ExpressionBacterialPromoterArabinose inducible arapBADAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
rat Kv3.1-HA
Plasmid#113055PurposeExpresses rat Kv3.1 in mammalian cellsDepositorAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSEM415 - mosTI unc-119 Pmex-5 - gfp(nls) - tbb-2
Plasmid#182358PurposePositive control for mosTI(unc-119). unc-119 rescue and germline nuclear GFP expression after mosTI insertion.DepositorInsertGFP
ExpressionWormPromoterPmex-5Available SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVpuro
Plasmid#134983PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPP5588
Plasmid#128708PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopD1
ExpressionBacterialAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only