We narrowed to 3,402 results for: aaas
-
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Npm1-R
Plasmid#122331PurposeExpresses sgRNA targeting mouse Npm1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Npm1
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
RACGAP1 E8.4 gRNA
Plasmid#90865Purpose3rd generation lentiviral gRNA plasmid targeting human RACGAP1DepositorInsertRACGAP1 (Guide Designation E8.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
CKAP5 C5.2 gRNA
Plasmid#90630Purpose3rd generation lentiviral gRNA plasmid targeting human CKAP5DepositorInsertCKAP5 (Guide Designation C5.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
PAFAH1B1 G9.3 gRNA
Plasmid#90822Purpose3rd generation lentiviral gRNA plasmid targeting human PAFAH1B1DepositorInsertPAFAH1B1 (Guide Designation G9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CENPF C6.1 gRNA
Plasmid#90617Purpose3rd generation lentiviral gRNA plasmid targeting human CENPFDepositorInsertCENPF (Guide Designation C6.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiRNACRISPR_005 - hU6-DR_BsmBI-EFS-RfxCas13d-NLS-2A-Puro-WPRE
Plasmid#138147PurposeExpresses RfxCas13d in mammalian cells, localized in the nucleus. For cloning of guide RNAs compatible with RfxCas13d. Contains a 5' direct repeat. Clone using BsmBI. F overhang aaac. R overhang aaaaDepositorInsertCasRx
UseLentiviralTagsNLSAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiRNACRISPR_006 - hU6-DR_BsmBI-EFS-RfxCas13d-NES-2A-Puro-WPRE
Plasmid#138148PurposeExpresses RfxCas13d in mammalian cells, localized in the cytoplasm. For cloning of guide RNAs compatible with RfxCas13d. Contains a 5' direct repeat. Clone using BsmBI. F overhang aaac. R overhang aaaaDepositorInsertCasRx
UseLentiviralTagsNESAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001147380)
Plasmid#80225Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-memRFP-3xPax7gRNA
Plasmid#224569PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and membrane RFP reporter.DepositorInsertmRFP1
UseCRISPRTagsMembrane localization signalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
non-targeting control gRNA (BRDN0001162235)
Plasmid#80261Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLK1 gRNA (BRDN0001144743)
Plasmid#76458Purpose3rd generation lentiviral gRNA plasmid targeting human PLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145269)
Plasmid#80249Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001149383)
Plasmid#80238Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDR211
Plasmid#113870Purposeexpression of Cas9 programming sgRNA3 and sgRNA4 targetting HXT8 and HXT1 respectivelyDepositorInsertsgRNA3-HXT8 / sgRNA4-HXT14
ExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-Arf1 gRNA
Plasmid#246572PurposeCRISPR vector co-expressing Cas9 and a mouse Arf1 gRNADepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only