We narrowed to 28,253 results for: tat
-
Plasmid#124873PurposeExpresses mouse CAD (Irg1) in E.coliDepositorInsertcis-aconitate decarboxylase (Acod1 Mouse)
TagsStrepTag and TEV siteExpressionBacterialMutationdeleted amino acids 1-3 and 463-end.PromoterT7Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
GPX8 rescue PLAK1
Plasmid#161517PurposeRescues the expression of GPX8 in GPX8 plenti-CRISPR KO cellsDepositorAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-Lb
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_SMAD-FOS_Mutant
Plasmid#194188PurposeIncludes the promoter (1kb) of SMTS with mutated SMAD/FOS binding siteDepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated SMAD/FOS Site, Region 3-15nt of 1000ntPromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_shRNA resistant nmPKA-Cα-mEGFP
Plasmid#114144PurposeThe G2A mutant of the mouse PKA catalytic subunit α C-terminally tagged by monomeric mEGFP. Silent mutations were introduced to make it resistant to shRNA knock-down.DepositorInsertmouse PKA Cα-mEGFP with G2A mutation and silent mutation to resist shRNA knockdown (Prkaca Mouse)
ExpressionMammalianMutationG2A mutation and silent mutation to resist shRNA …Available SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (IRES-GFP)
Plasmid#85181PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interaction. Co-expresses EGFP for selectionDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD
Plasmid#25049DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
BAP1 C91A
Plasmid#81025PurposeRetroviral vector containing human BAP1 C91A (catalytically inactive mutant) and Thy1.1 selection markerDepositorInsertBAP1 (BAP1 Human)
UseRetroviralExpressionMammalianMutationBAP1 C91A (point mutation, catalytically inactive)Promoter5’LTRAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (PGK-Puro)
Plasmid#63214PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interactio. Contains Puromycin selection markerDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449,548,732,899,884 (All)
Plasmid#194190PurposeIncludes the promoter (1kb) of SMTS with 5 mutated KLF binding sites (positions 449,548,732,899,884)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutation5 mutated KLF binding sites (positions 449,548,73…PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 899
Plasmid#194193PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 899)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 899)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 732
Plasmid#194195PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 732)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 732)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 884
Plasmid#194196PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 884)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 884)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449
Plasmid#194197PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 449)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 449)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449,548,732,899 (Quin)
Plasmid#194191PurposeIncludes the promoter (1kb) of SMTS with 4 mutated KLF binding sites (positions 449,548,732,899)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutation4 mutated KLF binding sites (positions 449,548,73…PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only