We narrowed to 10,354 results for: iCre
-
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmATM
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Mts D85N
Plasmid#208403PurposeExpresses FLAG-tagged Drosophila mts protein with D85N mutationDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Mts H59Q
Plasmid#208402PurposeExpresses FLAG-tagged Drosophila mts protein with H59Q mutationDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-Mts H241A
Plasmid#208404PurposeExpresses FLAG-tagged Drosophila mts protein with H241A mutationDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-UbC-3xNLS-mScarlet-I
Plasmid#191099PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-mScarlet-I
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationoptimized to human codon usagePromoterUbCAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP PHD-HAT
Plasmid#179548Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-LC3B Q116P G120
Plasmid#129290PurposeExpresses GFP-tagged deconjugation-resistant LC3B in mammalian cellsDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsGFPExpressionMammalianMutationChanged Glutamine 116 to Proline. Deleted amino a…PromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVE-FH-Dnd1-IN
Plasmid#70072Purpose2nd gen lentiviral vector. Cre-removable and tet/dox-controllable expression of FLAG-HA-tagged murine Dnd1 in mammalian cells.DepositorInsertDnd1 (Dnd1 Mouse)
UseCre/Lox and LentiviralTagsFLAG and HAExpressionMammalianPromoterEF1alphaAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pRK5-EGFP-Tau E14
Plasmid#46907Purposeexpresses EGFP tagged Tau E14 in mammalian cellsDepositorInsertTau E14 (MAPT Human)
TagsEGFPExpressionMammalianMutationall 14 S/P or T/P amino acid residues (T111, T153…PromoterCMVAvailable SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRK5-EGFP-Tau E14 P301L
Plasmid#46909Purposeexpresses EGFP tagged Tau E14 P301L in mammalian cellsDepositorInsertTau E14 P301L (MAPT Human)
TagsEGFPExpressionMammalianMutationP301L AND all 14 S/P or T/P amino acid residues (…PromoterCMVAvailable SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-mXFPm-IFNGR1(18-489)
Plasmid#192786PurposeExpression of mXFPm-tagged IFNGR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNGR1 (IFNGR1 Human)
TagsIg k-chain leader sequence and mXFPmExpressionMammalianMutationmXFPm: tryptophan 66 to phenylalanine, gluatmic a…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MARK3
Plasmid#23716DepositorInsertMARK3 (MARK3 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRK5-EGFP-Tau AP P301L
Plasmid#46906Purposeexpresses EGFP tagged Tau AP P301L in mammalian cellsDepositorInsertTau AP P301L (MAPT Human)
TagsEGFPExpressionMammalianMutationP301L AND all 14 S/P or T/P amino acid residues (…PromoterCMVAvailable SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only